Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22940  (registered. 2003)
Contig Information
Length 671 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_VHS Shoot with heat shock treatment 6
Homology (BLAST) Top Hit hypothetical protein OsI_08812 [Oryza sativa Indica Group]
Score 531
Evalue 1.868e-52
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22940
GGACGCACAGGACTAGAAGCGTGTCAGCATAGGCGAGAGCCAGAGAAGAGCTTGCAGGTGAGAACATGGCCGCAACGGCGTGCTCTACGGCGCTTCTGGG
TGTAGCAGGAGCACGCCTCCCCGCCGGCGCGCCGCCAACCGTTCTTCTCCCACGGCGTAACTTCTCCCCTCTTCGCCTCCAAGGCGCGCACGATGCACCG
CGGCTCTCTCTGCTCCGGGCGAAGGCCGCCTCCGATGACACCTCTGCCGCGAGCGGCGACGAGCTCGTCGACGACCTGAAAGCCAAGTGGGACGCCGTCG
AGAACAAGTCCACCGTGCTGACGTACGCCGGCGGCGCCATCGTCGCCGTATGGTTCTCCTCCGTCATCGTCGGCGCCGTCAACTCCCTGCCTCTGCTTCC
CAAAATCATGGAGCTTGTTGGGCTCGGCTACACCGGATGGTTCGTGTACCGCTACCTCCTCTTCAAGGAACGCAGGAAAGAGCTGGCCGACGACGTGGAG
TCTTTGAAGAAGAGCATTGCTGGTACAGAGGCAGAGTAATAAAAGAAAATAATGTTGTATGGATTATTATTTTGTTGGACGATTATTCAGAGAACGCTTA
TCCGAGGGTTTGCTTGTTTTTTTAACAAGACAAAAGACTTGCTATTTCCATTGATTAACAAAGAATGTTTA
page-top