Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22909  (registered. 2003)
Contig Information
Length 1003 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit hypothetical protein OsJ_026046 [Oryza sativa (japonica cultivar-group)]
Score 467
Evalue 1.02971e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22909
AAGGGAAATCGATGAATTCATCAATGAGGTTGCTATTCTTTCTCAAATCAACCATAGAAATGTGGTGAAGCTCCTGGGATGCTGCCTTGAGACAGAAGTG
CCTCTATTGGTTTATGAGTTCATTTCAAATGGAACCCTATACCACCATCTTCATGTTGAAGGACCAAAATCACTATCATGGGATGATCGTTTAAGGATTG
CACTTGAGATTGCTAGAGCTCTAGCCTATCTGCACTCGGCTACTTCAATGCCCATATTTCATAGAGATATCAAGTCCTCCAACATACTTCTGGATGAGAG
CTTAATAGCAAAGGTGTCAGATTTTGGAGCCTCAAGGTACATCCCAAGTGTTCCTTGAACAGCTGTCCCTCGTGCCGAATTCGGCACGAGGCTTCCTCCT
CTCCTCTTCCCTCGGCGGCGGCGCAGGCGGCGCGGAGGCGACAGGCGAAGGCGAAATGACGAAGGGAACGGGCAGCTTCGGCAAGCGCCGGAACAAGACC
CACACGCTGTGCATCCGCTGCGGCCGCCGCAGCTTCCACCTGCAGAAGAGCACCTGCTCCTCGTGCGGCTACCCCGCCGCCCGCATCCGCAAGTACAACT
GGAGTGTGAAGGCCATCAGGAGGAAGACCACCGGCACCGGGAGGATGAGGTACATGCGCCATGTGCCCAGGAGGTTCAAGAGCAACTTCAGAGAGGGAAC
TGAGGCCACACCAAGGAGCAAGGGAGCCTCTTCCAGCGGCAACTAGGCGTGGCGGCCTTAACTTGTTACGCTAGGCGGAGCCCTGATCACCAAACTTAGC
TTTTTTGTTGCTTTCTACTGGAACTCTATGTTTCTATGTCGAGAGGCGGACGATATGATGCCTGGTTATGTTATTTGCACAATTATCGTGGACGTTAATC
CTTCAGTTTTGAATGTTGAATTGTGTCGATGTCCTGTGTTAAGATGCTCTGCATCTCTTGTTCAATGCGCTATTTGTGATGAGGCTTTTTGTTAAAAAAA
AAA
page-top