Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22891  (registered. 2003)
Contig Information
Length 2106 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os01g0936100 [Oryza sativa (japonica cultivar-group)] >gi|57899629|dbj|BAD87256.1| putative protein serine/threonine kinase BNK1 [Oryza sativa Japonica Group] >gi|113534857|dbj|BAF07240.1| Os01g0936100 [Oryza sativa (japonica cultivar-group)] >gi|215715280|dbj|BAG95031.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2041
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22891
GCTTCTCCTGCTTCGGCCCGGCCCTGGAGGCGGAGGGCCGCAAGCCGGTGCCCGACGCCAAGGACCCCCGCGCCAAGGACGGCGCGGTCTCGGATCGCGC
CGGATCAGATAAATTGAGGCTGCAGGGTGGATCAGACCCTAAGAATAATCATCTAACCATCCCTCGCGATGGGAGCAGCCAAAACATTGCCGCACAGATT
TTCACTTTCTGTGAGCTTGCTGCTGCCACTAAGAACTTCAGACAAGATTGCATGTTGGGTGAGGGAGGTTTCGGACGTGTATATAAAGGTCGCCTAGAGA
GTGGGCAGGCTGTTGCTGTGAAGCAACTTGATCGTAACGGTCTCCAAGGAAATAGAGAATTCCTTGTTGAGGTCCTCATGCTCAGTCTCTTGCATCACAC
TAACCTTGTCAATCTAATTGGTTATTGTGCTGATGGTGACCAACGCCTCCTTGTTTATGAGTTTATGCCACTGGGCTCATTAGAAGATCACTTGCATGAT
GTGCCACCTGAGAAGGAACCTCTTGACTGGAACACACGGATGAAGATAGCTGCAGGTGCAGCCAAGGGCTTAGAGCATCTTCATGACAAGGCCAGCCCTC
CTGTTATTTACCGGGATTTCAAATCGTCAAACATTCTTCTTGGTGAAGGGTTTCACCCGAAGCTGTCTGACTTTGGCCTTGCAAAACTCGGTCCAGTTGG
TGACAACACTCATGTTTCAACACGTGTGATGGGAACTTATGGCTACTGTGCCCCAGAATATGCTATGACTGGGCAGCTCACAGTGAAATCAGATGTCTAT
AGCTTTGGCGTTGTTTTCCTTGAACTGATTACAGGGCGCAAAGCAATCGACAACACCAAACCCCAGGGGGAGCAAAACCTGGTGGCATGGGCTCGCCCAC
TCTTCAAGGATCGCAGGAAGTTTCCTAAGATGGCTGACCCAATGCTTCAAGGCCGGTTCCCTATGAGGGGTCTGTATCAGGCTTTAGCTGTTGCTGCCAT
GTGTTTGCAAGAGCAAGCCACAACCCGTCCTCATATAGGAGATGTTGTCACTGCTCTCTCATATCTAGCTTCTCAGACATATGATCCAAATGCCCCAACT
CAACATACTCGGAGCAATTCATCGACCCCTAGGGCCAGAAATGTTGGTGGGCGGAACAGCGAACAGCGCAACGGACGCTCACCAAATCATCATTCTCCTA
GGACATCAAAGCACGGAGGGGAGGTCAGCCGGACTAGTTCTACTGGTGGTGATTCTGGCCGGAGGTCAGGATTGGATGAAATGGACATGGCAGGATCACA
GGCAGGCAGCCCAGCACAGACAGGAAGGAAGAGAGAAACCCCCAGGACCGCTGACAGGCAGCGCGCCATTGCGGACGCTAAAATGTGGGGGGAGAACTCC
AGAGAGCGGAAGCGACCGAACGACAGCTTTGATAGTACAAATGAGTAAACTGGACAGTTCTCTTTCACGACGTCACTCTAGCAGGGGGTCGACGAGTTTG
CTCATCAGCACCAGACGGGCCAGGTTTAGGAACACGGTGTTTGTTCCAGCTCTGTCCCGTTGTCTGTGAATAAAGGCTTTTCTTGCCATCAGCACTGCCT
CACGGTTGCTTTATCTGTAAGTTGTTGCAGTTGACATGCCTTCTCCGGGCGGCGTCCATTCCTTGCGAATGTGATTGTGTCATGTACTCGTCTCCTTTAG
AGCTCAGGAGCCTACAAGATGCAGCTGGAAATGTAGGAAAGGGAACTGCAAGACCGTCGAAGCCGCAGAGCTGCGTCTGTCAGGCCCTTCCTTTCATTCT
TCTGCAGTTACACGATGTCGACGAGTACGCACCGCTGCACCTGTGTTCTGGAACTGATTGCGCAACCGTGCCAGGCAGTTTCTTCTGATGGATGAGATTT
CAGGTTTGGTTGGGGGATAGGATAGAGATTACCCATGTTTCGTACAGCCGCTATTGTTTTTGTGTCGAGTCGCGGGATCGGTCATTTATTTGTATTAGCT
TCGACGTACTTCTGCTTGTATCTTCGTGCGAACATGGTTTAGCATGCAGCAAAAGTACCAGGTTATTCAGAATTTCAGTGCCCATATGTTATCCCTAAAA
AAAAAA
page-top