Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22861  (registered. 2003)
Contig Information
Length 1669 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
Homology (BLAST) Top Hit hypothetical protein OsI_18555 [Oryza sativa Indica Group]
Score 2147
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22861
TTTTTTTTTTAAGGTGCGGAAAAATGCACTGAAATGGCAACATAATATTTCCTCTCCCAGGGTATCAACTCAAACAGAAGCTCTAATAACATCGACACCA
GTTTCGCACATTATTTAGGAGTATGGAAACATGCGGCCACAGCAAGGAAAGGGAATTTAACATCATGTAACTACAATCTGCAGCGAAGGTCGCAATTCAC
AGTTCCGCATACGAAACAAGCTCACAACAAAAAAGAAAAATTGATGTTTCTAGAACGCATCGATTCAAAATTATTTCAAAAACTTGCCAATTGTTTCAAG
CTGGCAGCTGAACTCATATCAGAAATCACATGTGGATCGCCTTGTCGTAGGTGTTCATGCACGCCTCCTTCAGGGCCTCACTCACTGTCGGATGCGCGTG
GCACGTACGGGCAATGTCCTCGCTGGATGCTCCATACTGAAGTGCAAGCACAGCCTCGTGGATGATCTCGCCCGCGCCAGGGGACATTATGTGTACGCCG
AGGATTCTGTCAGTTTCCTTCTCAGATATCACCTTCACCATCCCTTCGGCATCATCAATTGCCTTCGCCCGACTGTTTGCCAGCAGGGGGAACTTCCCAA
CCTGGTAGGCTACACCAGATGCCTTGACCTGTTCCTCCGTCTTGCCAACGGAGGCCACCTCTGGGTGCGTGTACACCACGCCAGGTACAGTGTCATAGTC
AACATGGCCCTCCTTCCCCGCGATAAATTCAACACATGCAACACCATCCTCCTCAGCCTTGTGTGCAAGCATCGGTCCAGGTATCGCATCTCCAATCGCG
TATACGCCCTTAACATTTGTCATAAAGCGATTGTCGACAAGGATCCTTCCGCCCTTGTCTGTCTCAACACCAATGGCGTCCAACCCAATACCAGCAGTGT
ATGGGACTCTGCCAGCAGATACAAGGACAACATCAGCCTCAATGACAGTCTGCTCTCCACCAGCTGCAGGCTCCACAGTTAACTTGACACCACTTCCAGA
GGTATCGACCCCAACTACCTTTGTCTTGAGCATGAACTTAAACTTTTGCTTCTCTAGCATACGCTGAAACTGCTTCCTTATCTCTCCATCCATTGATGGG
ACAATATCAGGGGCAAATTCAACCACAGTCACTTCAGACCCTAGCCTGTTCCAGACAGAACCCATCTCTAGACCTATGTATCCAGCTCCAATGACCACCA
ACTTCTTTGGTATTTCTGTAAGTGCAAGAGCCCCAGTAGATGACACAATCTTCTTCTCATCAATTGTAACTCCAGGGAGAGATTTCACATCTGAGCCAGT
GGCGACAATTATGTTCTTCCCTTTGACGATAGTGCTACCACCATCAACTAAATCCACAGATACCTCTGACGGAGAGACAAGCTTCCCAAACCCTTTAACA
TACTCAACCTTGTTCTTCTTGAACAGGCCTTCGATGCCCTTTGTAAGCCCAGAAACAGCCTTGTCTTTCTGAGCCATCATTGCAGGCAGATCTACCTCCA
GATTGGAGAACTTAACGCCATGGTGTGCAAAAGAAGACTTTGCCTCATGGTACATATGCGACGAATGCAGAAGAGCCTTGGACGGGATGCAGCCGACGTT
GAGGCAGGTCCCCCCGAGCGCGCCCCTCTTCTCGATGCAGGTGGTCTTAAGACCGAGCTGCGCCGCCTG
page-top