Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22841  (registered. 2003)
Contig Information
Length 1532 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 4
Homology (BLAST) Top Hit hypothetical protein LOC100193449 [Zea mays] >gi|194693270|gb|ACF80719.1| unknown [Zea mays]
Score 1489
Evalue 5.80614e-163
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22841
TAATTGGTTATCTCAGATGCTTCACAAGCGTCTAAGGAAAAAAATGTCTCACAAGAGGGCCGAAATGAAAATATGGTCAAAAGTCAGCAATCCAGCATTT
CAGTGATTGTATCTAACCAGATTGCTATGAAAAAGGCGTAACAAGTGACAGCGCCACGGTACATTGGAACTGCACTGCACGCTCTCCTGGAGAGTTATAT
ACAGCATAACAGGATGCCAAATTGCTAATTCTTGCAACACCATTCAGGCCAGGTTCCCAGCGGTTGAAGTTTATGAAGGCTGTGGAGTTTCGTCAAGGCG
GAACATGTTTATCTCTTGCTGCTTGAAGTATCTCCGGTCTTCCTCGTCCACAAGGACCAGGTTGAGGTAGTACTTGACACTGAACTTGTTGTTTATGTTG
CGGTAAGTCGGGGTTAGCTCGTATGGAGTCAAGAATAGCCTTACAGGAATAGACTCTCCTCTGACTGGGGCACCATCCATCAGCTCAAATTTAGCAAGTG
TCTCAGTCTCAACATATGTGTTAGGACCTGATCCTGTTGATTCCCGGCGGCGAATCTCAAGCTCCATGTTTTTTATCTTTATTCTGACTAGAAGAAAATA
GATCTTTCCTACAATGACATCCTTGAGATGGTACTTGCTTTTGCTGTACTCAAACTCAATATGCAGGCAATCTTCAATTCCAACTTCCATCTTGATGCTG
TTATTGATTGAAGGAAGAGGAGAATAGTTCCTTACACAGAAATCCCGAGATTCCACAATATTACCAACATAGTTTCTACCAATAGTCACTTTCAGGATGT
ACCTCAGTCTGACATTTGTTCCATTGTATGACTCATATGGCATTTCAACAGTAGAGAACTCAAATGGATATGTCTTTCTTTCATATATTTCACCAGGAAC
ATCTAACTCACGCACCAGTGAAGTGAAGTCATAGAAGTTGCCTCTGTCGAAATACAACTCTATCTGTCCAAGCAGCTCAATCTTAACACCCATGTGCTCA
ATCCTTTTACCAGGAACAGGCGCTATTGATACCTCTCCGGCTATGGTCTCCAGGCTCTGGAACGCCGGCACCATGGTTGTCTTTCCATTATCCTTCTTGA
CTGCAACCTGCTTCCGGCTCCTCTCATCGGAAAAGGTCACGAAGATGTCGCAGGGCGGCTTGAAGGCGCCGATGATGTAATTCATGGCTACGTCGGAACA
AAAGAAAAGGTGGATGTGGAGGGCGACGCGGGGACGATAGCTGAGGAAGGTCGCCGACGCCGGAGGAGGGGATCACCGGTGTTGTTGGAGCTGGGCGTCA
AGCTGCCGGGTCGGCCTCGTGCCGAATTCGGCACGAGGCTTGTTGACACCAATGGCGCTGGTGATGCGTTTGTTTTCCAGAAGCCAGAGGCAGTTGTGAG
ATCTTCAAAGCGATCTCCTCGACATTCTCAGTCTCCCACCCTCGGACTTTAGAGAAGATCCTTGCCTCAGTTTCATTTCCAAAGATATAGTCCGCATACG
GAAGAACCTTCTCTTGGGCATCACGGAAAAAC
page-top