Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22825  (registered. 2003)
Contig Information
Length 1176 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os07g0570700 [Oryza sativa (japonica cultivar-group)] >gi|158513666|sp|A2YMU2|RRFC_ORYSI RecName: Full=Ribosome-recycling factor, chloroplastic; Short=RRF; AltName: Full=Ribosome-releasing factor, chloroplastic; AltName: Full=Protein OsL8; Flags: Precursor >gi|158513703|sp|A3BLC3|RRFC_ORYSJ RecName: Full=Ribosome-recycling factor, chloroplastic; Short=RRF; AltName: Full=Ribosome-releasing factor, chloroplastic; AltName: Full=Protein OsL8; Flags: Precursor >gi|34394208|dbj|BAC84660.1| putative Ribosome recycling factor, chloroplast precursor [Oryza sativa Japonica Group] >gi|113611583|dbj|BAF21961.1| Os07g0570700 [Oryza sativa (japonica cultivar-group)] >gi|218199871|gb|EEC82298.1| hypothetical protein OsI_26546 [Oryza sativa Indica Group]
Score 862
Evalue 2.04954e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22825
TTTTTTTTTTGCCCAATTTGTAGCACCCGATTGCAGTGGAGCCTGGCCCAGGGTATACAATTAGCAAAGGAAACATGAAAAGAACTTTTAGAGTGCACAT
CACAGAATTTAATTCGTGGAAATATTGACAATGGCAGTCGGACGGGAAGACGGCGAAGGCCTAATTACAAAAGGGAAACCATAGAGCAGCAACACTGTCT
CAACTTTGCATCCATCAGTCTTAGCGAGACTCCAACAACCCAACGAGTGCACCCCATCGCACTGGCAGCCATCCGATGACCAGAGGAGGGCTTCAGAAAA
CATGTAGCCAGTTTTTGTTCAGTCGGGTCGGGATCTAAACCTTGCTCAGCTCCTGTTCCTTCTGCTTTTGGATGGCTTCAACCTTTTTCATGTACTCGTC
TGTGATTTTTTGTAGATCGGCTGATAAATCCTTCACATTATCTTCAGAAAGTTTCTTTTCCTTCTCTAGCTTATCATAGGCTTTGATTGCATCTCGTCTT
ATGTTTCTGATAGCAACCTTGCCTTCTTCAGATAACTTGGCTACGTTTTTTGTCATTTCCTTTCTGCGGTCAGATGTCAATGGTGGGACAGTGACTCGTA
TCACTTCTCCATCATTGCTTGGTGTTACCCCAATATTTGCAGCAACTATAGCTTTCTCAATGAGCTTGAGGCAAGACTTGTCATATGGTTGGATAAGAAG
AGAAGTCGCATCTGGGGTATTTATCTGTGCAATAGTCTTCAAGTTTACAGGAGTTCCATAGTACTCAACCTCAATCCTGTCGAGCATAGACGGGTTTGCC
CGCCCAGTCCTGACGGTATTGAAGTTCGATTGAACTGTTTCAATGGCCTTCTCCATCTTTTCTTTAGCTTGTTCTTCAACGATCATCTTTTCTTCCTCAA
TTTCTTCATTAGTGGCATGCCTCAAAACTGCTCTCTTGTCCGAGTGTTGAAGAACCAAAGGCACACCAAAGAAACCCACTGCTCCAGACTGAAATTTCAT
GAAGTTTGTGGACGAACTTAACAGGGATGAACGGTTTGAGAGACAACCACAACCTGGGCGCTGGGGCAGACGGGCAGAGGAGAGGGCGCAGGGCGGGGAG
GCCGCCGCCGCAGGGGAGACGGCGTGGAGCGCCATGGCGCGGCAGCAGGCGGAGTGGTAGCGAGGGGAAGGCCGAG
page-top