Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7625  (registered. 2012)
Contig Information
Length 1463 bp
Clones alternative view 190 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 6
Wh_r Root 11
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 9
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_SP 12
WH_XA Root 17
WH_XB Root 16
WH_XC Root, treated at 50 microM Al for 6h 20
WH_XD Root, treated at 50 microM Al for 6h 13
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|50659026|gb|AAT80326.1|| UDP-D-glucuronate decarboxylase [Hordeum vulgare]
Score 706
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7625
CGCCTCGTCGTCCGCCCACGGTCTAATCCGATTCAAACGCACCGCTTCCTCGTGTCCGAACTAAGCCCCAATCCCGTCACCACCGCCGCTGGTGCTCGGC
GCGATGGCGCAGAAGGACGCCGCCAATGGCAACGGCGCCACCACGCGCCCGCCGCCCACTCCCTCCCCCATCCGCTTCTCCAAGTTCTTCCAGGCCAACA
TGCGGATCCTGGTCACCGGCGGAGCTGGCTTCATCGGCTCGCACCTCGTCGACAAGCTCATGGAGAACGAGAAGAACGAGGTCATTGTTGCTGACAACTT
TTTCACTGGGTCAAAAGACAACCTGAAGAAGTGGATCGGACACCCAAGATTTGAACTCATCCGTCACGATGTCACCGAACCACTGCTCGTGGAGGTTGAC
CAAATCTACCACCTTGCTTGCCCTGCCTCACCAATCTTCTACAAGCACAACCCTGTCAAGACCATCAAGACGAATGTCATTGGAACCTTGAACATGCTTG
GACTTGCAAAGAGAGTTGGAGCTAGAATATTGTTGACTTCGACCTCTGAAGTTTATGGTGATCCCCTTGAGCATCCTCAGACGGAGGCGTACTGGGGCAA
TGTTAACCCAATTGGAGTCAGGAGCTGCTACGATGAGGGTAAGCGTGTAGCTGAGACACTGATGTTCGACTACCACAGGCAGCACGGCATTGAGATCCGT
ATTGCCAGGATTTTCAACACCTATGGACCTAGGATGAACATCGATGATGGCCGTGTTGTTAGTAACTTCATTGCTCAGGCCATTCGTGGTGAAGCACTGA
CTGTCCAGAAGCCTGGAACACAGACCAGGAGCTTCTGCTACGTCGCTGATATGGTCAATGGTCTTATGAAGCTGATGAATGGAGACAACACCGGACCCAT
TAACATTGGGAACCCAGGTGAATTCACCATGCTGGAACTTGCCGAGAATGTGAAGGAGTTGATCAACCCAGAAGTGACAGTGACGATGACTGAGAACACT
CCTGATGACCCTCGCCAGAGGAAGCCTGACATCACCAAGGCCAAGGAGGTTCTCGACTGGGAGCCCAAGGTCGTCCTGCGCGACGGCTTGGTGCTCATGG
AGGACGATTTCAGGGAGCGTTTGGCAGTGCCCAAGAAGACCAAGGCCTAATTCCCCTCCCTACGTTTGGCGTACAACATCACCAATTTGCCAGAGCATAC
TCATAGTTGGGTGGGTTCGTCAATATTCGTTGCTGCGTTTCGTTACGGAATTTGAGTTCCAATAAACCAATTACACCTTCGTCGTTCACTTGAAAGATTG
TATTATTAGAAACTTCATACAAGGCGTGGCTGTTTGTATTACCGTCGCTTTTTGCGGAACTTGTGCTCCTTATGTTTTAGCATATGAACTTCCCTAAATC
AATTATAGCAATGTTCGTGCCATTTAAAAAATGTTATTAAAGTTTTTTCTGCCAAAAAAAAAA
page-top