Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22814  (registered. 2003)
Contig Information
Length 930 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1344
Evalue 1.85133e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22814
TCTTACGTTCTTAGACAATCGAATCCTCGTAATTTACATCATGGGTAGTACAACTCAGACCACACAACAGCATGCTTCACCGGGAGCACACACACCTTAC
TTGCCAGGAACGAAGTTGGTGGCAAATGCCCAGGCATTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCGAGTGGACCCTTGCCGGTGACGA
TGGCTTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGACCGTTCTTGATCTCCTTAACCTTAAGCTCGGCGAATGCCTCAGGGTCGTCGGCAAG
GCCAAGCGGATCAAAACTGCCGCCCGGGTAGAGTGGGTCGACGATCTCACCGAGTGGTCCACCGGCAACGCGGTAGCCCTCGACGGCGCCCATGAGCACG
ACCTGGCAAGCCCAAATGGCAAGGATACTTTGCGCGTGCACAAGGCTTGGGTTGCCGAGGTAGTCAAGGCCGCCCTCGCTGAAGATCTGGGATCCGGCCT
TGAACCAAACAGCCTCACCAAACTTAACGCCGTTGCGGGCGAGTAGCTCGGGGAAGATGCAACCGAGCGCGCCAAGCATGGCCCAACGGCAGTGGATCAC
CTCGAGTTCCCGGTTCTTGGCGAAGGTCTCGGGGTCAGCCGACAGACCAGCGGTGTCCCACCCGTAGTCGCCGGGGAACTCACCGGTCAGGTAGCTCGGG
GGCTCACCAGAAAGCGGGCCCAGGTAGAGCACGCGGTCAGAGCCGTACCACGGGCTACTAGAGGTAACCTGCTTGGCCTTTGCCGCCGTCTTGCGCATGG
TGACGCGAGCCTCCCCAAAAAGAGATGATGATGGCAAGTTCTTCACTGCCTTGCCGGCGAAGGCTGGGGAAGAGAGTGACATGGTGGTTGCGGCCATTCT
GATTGACTAGGTTCTGTGTTGTCTCCAAGA
page-top