Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22786  (registered. 2003)
Contig Information
Length 1603 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit sucrose-6F-phosphate phosphohydrolase SPP1 [Triticum aestivum]
Score 2119
Evalue 0
Total Hit Count 178
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22786
GCGGCGGGTCGGCGCTCTCACCAAGCAGCAGTGGTGGACACCGCGCGGCTTTGCGCGGCGCGCCGGCGGCTACCAGCGGCAGATCGACCGTGCGGCCGCA
GGCCATCGGGCTCCGCTCAAGGTTGCTAAAATGGATAAGCTCAAGGGCTCTGCACGTCTTATGATTGTTTCAGATCTCGATCACACAATGGTTGATCATC
ATGACGAAGAGAACTTGTCTTTGCTTAGGTTTGGGGCCCTTTGGGAGTCTGTTTACTGTCAGGATTCTCTTCTTGTCTTTTCAACAGGAAGATCACCTAC
TCTGTATAAGGAATTGAGGAAAGAGAAGCCTATGCTAACTCCAGACATCACTATTTTGTCTGTGGGCTCTGAGATAACTTATGGTGAAGCCATGGTCCCT
GATCATGGCTGGGAGGAATATCTGAACAATAAGTGGGACAGGAATATTGTTCTTGAGGAGACAGCTAAGTTTTCTGAGCTGAAGCTTCAGGTAGAGTCAG
AACAGCGTCCACATAAGGTCAGCTTTTTGGTTGACAAGAAGAACGCTCAGGGAGTGATCAAGTCTCTCTCGGAGAAGTTTGAGAAACGTGGGGTAGATGC
GAAAATAATCTACAGTGGTGGCCAGGATCTTGACATATTAGCTCAAGGGGCTGGAAAGGGTCAAGCACTTGCATATTTGCTCAAGAAGTTAGGTTCATGC
GGAAAAACACCCAACAATACTCTTGCTTGTGGTGACTCTGGTAATGATGCAGAATTATTCAGTATCCCTGGTGTACATGGTGTCATGGTTAGCAATGCCC
AAGAGGAACTACTCCAGTGGCATGCAGAAAATGCGAAGGATAATCCTAAGATAATTCATGCAACTGAGAGGTGTGCTGCTGGTATTATTCAAGCTATTGG
GCACTTCAAGCTAGGACCTAATGTTTCTCCAAGAGACGTTGAGTTCCCTTACATCAAGGAGGACCCTTTCAAGCCTACAGCGGCCATTGTGAAGTTCTAT
GTTCTGTACGAAAAGTGGCGTAGAGCTGATGTTCCAAAGGCTGATTCTGTTATAGAGTACTTCAAAAACACCACAGATGCAAATGGAGTTATTATTCATC
CGTCTGGGGTCGAACTTTCGATCCATTCGTCCATTGATGAGCTGGCTTCATGTTATGGTGACAAACAAGGGAAAAAGTACCGATCATGGGTGGACAGACT
TGTTATCTTGCAGACTGCTCCTGACAGTTGGCTTGTGAGATTCGACTTGTGGGAGGCAGAAGGTAATGCGTGGGCGTGCTGTTTTACAACCCTTGCACTG
AATGTAAAGCCTGAAACCCCTGGGGGTTTTGTGGTAACACACATCCACAAGACATGGCGTAAAGAATATCCCGGGGTCGAGCAGTCATCCAAACTCTAGA
CTGGACCGCCACCGCCGGCGCACGGGAAGGAGTTTTTCTTCTTCTTGAGGATCAAATAAGAAATCGTAGCGAAAGCATGAGAATTTCTTTTACTTGTTCA
TAATCTTAATAATAAGTGCTCCCAGACACATATACTGGGCTGGATGATGTCTACGGAGGTCTCTTGATGCCTTTGGCTAATGCTTACTGTCATGAGAGGC
TAA
page-top