Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22742  (registered. 2003)
Contig Information
Length 738 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 8
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 463
Evalue 1.74911e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22742
GCTTCCACCCACTCTCAAACCCTCTCGCCGGAGCCCGAGCAAGCCAGCAAGCAAGCAAGATGGACGGCAGCAAGGCGAAGAAGGTGGCGGCGAAGAAGTT
CGGCGGGCCGAGGAAGAAGTCGGTGACCAAGTCCATCAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTACGCC
CAGCGCGTCGGCTCCGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCAGCAGAGGTGCTGGAGCTGGCCGGGAACGCCGCCAAGGACAACA
AGAAGACCCGGATCGTGCCCAGGCACCTGCTGCTGGCCATCCGCAACGACCAGGAGCTCGGGAGGCTGCTGAGCGGCGTCACCATCGCCCACGGCGGCGT
GATCCCCAACATCAACCCGGTGCTGCTCCCCAAGAAGGCCGCTGAGAAGGCTGAGAAGGCCGGCGCCGCCCCCAAGTCGCCCAAGAAGACCACCAAGTCC
CCCAAGAAGGCCACCAAGGCCTAGATCCGGCCGTGCCGGTGAACTGATGGTGCTCCGGCAGCCCTCGTGTGCCTAGTGTCTCTGTGTTAAGTTAGCTATG
GTGTGTTCCAGAGAGTGTTGAAGCTTGTCCTTTTGCTTTGCCCCACCATGTAACCGTGAACGAAGAGGAAGCGTCTTGCTTCCTCTGTTCTTCTGAATCC
ATCTGGTGTCTAATGCAGTGTTGTTAAAGTGCCTCTGA
page-top