Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22736  (registered. 2003)
Contig Information
Length 800 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit deleted in split hand/splt foot protein 1 [Zea mays] >gi|195629800|gb|ACG36541.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195652413|gb|ACG45674.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195653029|gb|ACG45982.1| deleted in split hand/splt foot protein 1 [Zea mays]
Score 125
Evalue 3.19386e-05
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22736
TTTTTTTTTTGTTGGAATCTCTAGAAAGAGATATATTTAGGAATGGAGGGAGTATCACTGTTCGACAAGTTGTGCTGCTCGCAGCCAATAACTACATGCA
GTACGGTACGAAGTCTGATACACAGTGCTGAAACGAAGATAAGTATCAGAGCTTGATATTGCTAGGGAAGTATCGCAGGTTCAGAGAGCAACGGCCACAC
AGTGCCTGATCGAAGATAAAGTTTACTACAGCTTTGATATGGATGGGGAAATAGTTCAGCTCTTCTGAGTGTTGCCTCCCTCCAGCTCTTTCCTCAGCTG
CAGTGAGAAATCATCGTTCACGTCGTCATCATCCCAGTCATCCTCCCATTGCTGGACAGCTTCGTTGCCATCTTCCTTGTCATCCCATTCTTGGTCGATC
TCGAACTCCTCGAACTCGTCGTCGTCCTCGAGGAGGTCCATCTTGGCGGCCTCCGCCTTCGCGTCCGCCGGCGCTGCCGCCGCCATCGATGCTGGTGCTA
GTATCTAGCTGATTCGCGTGGAGAAGAAGAAAGGGGGAACCCTAGACCTGGGCGCGGCTGCTCGTCGGGAGAGATGCCAGCCTGATCCTCGTGCCGAATT
CGGCACGAGGGAGAGCCATGTATCAGTGTCTGTACTGGCCTCTGCTGCTATGAACGCTGGTGATGACTGTGCGGAAGTTCANAATGTTCCATCCACCCCA
TTCTGAAAGAGGGGGCAGCATGGTANAAGTTGATGCCNTCTAGAGATGATGCTACCTCTATTTGTGAANTACGCAAGGATCCTGANAAGNAATGTATCTG
page-top