Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22731  (registered. 2003)
Contig Information
Length 2165 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_00556 [Oryza sativa Indica Group]
Score 1033
Evalue 2.15933e-165
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22731
CAGGCCCGTGGACGGCAAGCACTCACTCCGCCGCTCCCCTCCCCTCTCCGCCAGCTCGTCGCCGGGCGGATCCCCATCTCCGGTCTACCTTTTACAAGAT
TCCCTATTTATCGTGAGAATGAAGCGCATGAGTAGAATGCCCACAAGGAAGGCCCATTCATGGTGGTGGGACAGTCATATTAGTCCCAAAAACAACAAAT
GGCTAGCTGATAATCTAGAAGAGATGGATAAGCAAGTTAAAGAGATGCTGAAGCTCATTGAGGATGAAGGAGATTCTTTTGCAAAGAAGGCTGAGATGTA
TTACCAAAGGCGGCCTTTGCTTGTCACCCATGTTGAAAATTTCTACCGCATGTATCGTGCTCTTGCTGAGCGTTATGACAATGTGACTGGGGAACTACGA
AAAAACATGCCATCATCTCTCAAATCACAGGGCTCAGGTATATCTGAATCTGACTCTGAGGCACAGTCTACTCCCGCATCTCCTGAGTCTGAAAAGAAGA
CCTCAAAACAGAAGGGTAAAAAGGGAAGCGATGGATCATCATCATCTTCTTCTTCTGATTCTGATTCCGAGGTTGATGAAGTGAACCAAGAGAATGGCAA
TGGGATTACTCATGCACTGAACGAACGAGTTATTGAGCTAGAAGATGAGCTCAAGGAAGCAATGGAGAAACTTGAGGCACTCGAGGAAAAGAATATGCGG
TGCCAATGTGAAAACCTTGAAGAGAAGTTGCTAACTTCACAATCAGAAATCAACAGCCTTCAGAAGGATCTTGAAGAAAAGGTCCGTTCATTGGAGAGTA
TCAAAGAAATTAGCAGTGAAAAGGAGGATTTGGAAGCTGCAGTTCTGGAAAACAAGTACAAGTTCGAGGAATTAAAAGGGGAAATGGCCTTAGCAGCCAA
GCATCATGAGGCCCAACTTTCATATCGTGACCTTGAAATTGAGAAATGCAAGCGGGAGCTTGAGGAAGTATCTGAGAGGCATACCTATGATAAGTCTATT
CTTGAGACTGAAATCGGAGATCTCCAAGAAGTGGTCAAGAACTTGGAAGGGAACTTGGCAAAACTGTCGGAAGAGAAGTTGCAGCTTGAGGCACAGGTTA
TGGAGCTTGAACAAACATCTCACAGCCTAGATGATTCATCTGCTGAAATTAAGAAGCTACAAAAGGTAATCAAGGATCTGCAAGCAAGACTGGAAAATGA
TTCAAATGAGAAGAGAGTGCTCGAGGAACGTGCTATCGAGTTTGAGCAAGTTCATAGGGAAGTTAGAGGATTCGAGGGCTGAAACCAGTGGAGCTACAAA
CTAGAATTGAGAAACTCAAAGCTGATCTGGAAGGAGCACTTCAAGAGAAATCGATGTTGGAGGGCTCTGTCAAGGATCTGGAACATGCCATTGCTAGTAA
GTTGGAGAAATTCTCTCTTGAGAAGTCCTCTCTCGATGCTGAGATCCTACAACTGTCAGAAGCTAATGCTTCTCTTGAAGACAAGTTGTCATCCACAGAG
GCGCAGCTTAAGCAACTTCATGCCGAAAAGGCAGAAGCATCTGTTGAGAGTGAGAAACTGATCTCTGGATTGAAGCAAGATATTGCCAATCTTAAGACAG
AGCTCGAGTTACTGTCCTCACAGAAAGCTGCAGTTGATAATAAGGTGTCTGGTTTGCTGAGTGATCTCGCAACTTGTGATGAAAAGATGAAGGAGATGGA
TAGCCACTTGCATCAGCTACACCTGGAGCATGTGCAAGTGATAGCAGAGGCAGATGCCGCACGGAAGTCCGTGGCAGAACTGCGTGCACGGGTGCGTGAG
CTCGAGGAAGAGGTTGAGAGGCAGAAGCTCATGGCGTTCGACAGCGCAGAGGGGAAGCGGGAGGCAATCAGGCAGCTGTGCTTCTCGCTCGAGCACTACC
GTGACGGGTATCAGCAGCTCCGGCAAGTTCTGCAGGGCCACAAGAGGCCGATGGTGATGGCGACGTGATCAGCCAACCAGCAGCTTGCTGGATCCTTCTC
TCTGGATGCCTAAAATCAGTATGTCCATGTAATGTAAACATCCCTTTCCCTTTCCCCTTTCTTCATGTAGCTTCGGTCTACTCCTTAGTAGTCCTGGTAA
AAGCTTGTGCTCTGTAGTTGCTTCAGCTACTGGTACCCCTATGATGTGTGTGGTGTAATATATTA
page-top