Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22721  (registered. 2003)
Contig Information
Length 1594 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit Os01g0128400 [Oryza sativa (japonica cultivar-group)] >gi|9558458|dbj|BAB03379.1| unknown protein [Oryza sativa Japonica Group] >gi|113531443|dbj|BAF03826.1| Os01g0128400 [Oryza sativa (japonica cultivar-group)] >gi|218187445|gb|EEC69872.1| hypothetical protein OsI_00236 [Oryza sativa Indica Group]
Score 1413
Evalue 3.98626e-154
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22721
TTTTTTTTTTCAAGTTTCAACAGCACTTTTGATTTAAAAACCAAAACTGTCTCAGACCAACACGACAGGCAGGATTTCTAATCAGTCCACAAGGTCGGGC
CATTTGGCCCGAACCTTCTCATCCTCCTCACGGATATCATCAGTCTACGGATTAATTAACATAACTTAAAAACAACTGTCGCTGCCACCTCCTCCCAGGA
GGAACTGTCTTGGGATAAAGGTGCTAAAAACGGTAAACAACTCAGACGAACTAAGTATATCTCTCTCTTTGTCTAGGACCTATCCTCTCCCCTCTTTATT
TCTCTCCCCTCTCCACTCTCCACTCTCAGTATAAACGCTATGTTCAGAAGGACCGCAGGTACTCCGACGCCATGGCCTGGAGCTCCAGCGCCATCGCCTG
GAGCTTCTCAAGGTCGGCGGTGAGGTCGAGGTTGGGGGAGAGCATGAAGCCGGCCCCGGCCGCGAGCGCGATCACCAGCAGGCTGCCCTTCAGGCAGGTG
GCGCCGCGCGACAGCCTCCCGATGATGGCCTTGCAGTACTTGTCTGCCTCCTTGATGGACGCCTTCTCCCCAGAGTCCTCTGCTTCCTCCAGAGCAGCCT
CATTCTTAGCCTTGAGGCTCTTCAGAGTTGCTTTAAGAGCTTCAGAGTTGAGCTTGGGAGAGAGTGTCTTCCAGTCTGCAGTGATTTTGCGCAAGACCGC
AACACTGGCTTGGATATTCTCTGCATGAAGCTTGTCCCACAGCTTGTAGGACTCTGGACTCTGAGTCAGGCACCAGATGAACACATCGGTGGCCTCCTTG
GCAAGCTCTGCATTATTTTCTTGCATTGCCTTCACAGCCAAAGGCAGAAGCTGCTGTGATGCTTGCTTCACAGCTTTGGAGCCAGGAGTACCAACAAGAG
CCAGCTCCTTTATTATTGGGTAGGCTGCTTCAAACCTTTCTGTAGCCTTGACGCGTGCATTAGGCACGGGAAATGTGCATCTCATAAAGAGATCAAGTGT
TCCAGCAGGAACCAGGCGCTCCCCCTTTCTAACGGCGCCATTCAGTAGCATAGCCCGAGCTTTGGAGGCATTAGGGGTAGACACAAACCTCTCGAGCAAC
TGCAAAACAAGATCTCTTGACTGAGGATTCACACTTGACTTTGCACACACACTGGGAAATAGGGAATGCGACCAGCAAAACATTCCCGAGACTAGGTCGC
CTTGAGATGCCTGATTAATAACCCAGGCGATGATGGGAAGCTTTTCCTGTCCAAGATATTTACTGTTCCCCACTATTTTGGGGGAGAGGTTTATTAGTAC
ATCTGGCTTCCTTCTTAAAGTCAAGGCAAGCACAACAAATATTGCAACCTGGGCTTTTGGAGTTTGTTGAACAACCTTCTTCGCGCCCTTAGGTCCAACA
GTTGGACCTGACAACTCCGACATGATGCTATCTATACACCACAAAACAAATTCTCCCAATGCATCAGGAGATCTCTGGCTGATCCAATCACTTGCAGTCT
TGCAAACTGGCTCAGGAACATGGGACAATGGTACATCAACCATCTTGGGCATGGGTGACTCCTTGAACATCTTCGCCCAGGGGAACTGGGCCGC
page-top