Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22704  (registered. 2003)
Contig Information
Length 2306 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Homology (BLAST) Top Hit Os02g0525900 [Oryza sativa (japonica cultivar-group)] >gi|49388280|dbj|BAD25398.1| putative acetyl-CoA synthetase [Oryza sativa Japonica Group] >gi|49388286|dbj|BAD25401.1| putative acetyl-CoA synthetase [Oryza sativa Japonica Group] >gi|113536526|dbj|BAF08909.1| Os02g0525900 [Oryza sativa (japonica cultivar-group)] >gi|125582341|gb|EAZ23272.1| hypothetical protein OsJ_006755 [Oryza sativa (japonica cultivar-group)] >gi|215694616|dbj|BAG89807.1| unnamed protein product [Oryza sativa Japonica Group]
Score 3367
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22704
GCGGGAGGGACCCCGGACAAGCTCCGGCACGTCGAGTCCATGTCCGAGCGGCCCTCCGGCGCCGGGTCCATCTCCGGGATCAGCGCCGTCGTCCTGGGCG
AGTCGCTCGCCGACGAGGAGCACGAACTCGTCTTCCCCAGCGCCGAGTTCTCCGCCACCGCGCTCGTCTCCTCCCCCCAGCAGTACAAGGAGATGTACGA
GAGGTCCATCAAGGACCCGGCCGGGTTCTGGTCAGAGATCGCCGACGCCTTCTACTGGAAGGAGAAGTGGAACCCCAACGAGGTCTGCTCCGAAAACCTC
GACGTCAGCAAGGGCCCCGTCCACATCAGTTGGTTCAAAGGGGGCAAAACCAACATATGCTACAATGCCGTCGACCGCAACGTCGAGGCTGGGAATGGGG
ACAAGATTGCACTGTACTGGGAGGGCAATGAGCCCGGCCAGGATGGGAAGCTCACCTATTCTGAGCTCGTGGAGAAGGTTTGCCAGCTTGCAAATTACTT
GAAAAGTGTTGGTGTCGGCAAGGGGGATGCTGTGATCATCTACTTACCGATGCTGCTGGAGCTTCCCATTGCCATGCTTGCATGTGCGCGTATCGGTGCT
GTCCATTCGGTTGTGTTTGCTGGCTTCTCTGCGGATTCGCTGGCCCAAAGGATCGTTGATTGCAAGCCTAAGCTTGTGCTCACTTGCAATGCCGTGAAAA
GGGGGCCCAAGCCCATTCTTCTCAAAGATATAGTGGATGCTGCTCTGGTGGAAAGTGAGAAGAATGGATTCTCTGTAGGTATTTGTTTGACATATGAAAA
CCAGTCTGTAATGAAGAGGCAAGACACAAAATGGCAAGTGGGAAGAGATGTTTGGTGGCAGGATGTTGTGACCAATTTTCCTACCAAGTGTGATGTGGAA
TGGGTGGATGCGGAGGATCCATTGTTTCTTTTGTACACGAGTGGCAGCACCGGAAAACCAAAGGGTGTTATGCATACTTCTGGGGGCTATATGGTGTATA
CTGCAACAACATTTAAGTATGCTTTTGATTACAAGCCAACAGACATATACTGGTGCACTGCGGACTGTGGCTGGATTACTGGACATAGCTATGTGACATA
TGGCCCACTCCTGAATGGAGCTGCAGTTCTTGTTTTTGAAGGGACTCCAAACTACCCTGATGCCGGTAGGTGCTGGGACATTGTGGACAAGTACAAGGTG
TCGATATTTTATACCGCGCCAACACTCGTCCGTTCACTCATGCGCGATGGTAATGAGTATGTTACACGCTACTCTCGAAAATCTCTCCGAGTCCTGGGAA
GCGTTGGTGAGCCAATTAATCCTAGTGCATGGAGATGGTTCTACAATGTTGTTGGGGATTCAAAGTGCCCCATATCAGATACTTGGTGGCAGACTGAAAC
TGGTGGCTTCATGATGACTCCTTTACCTGGTGCCTGGCCTCAGAAACCGGGCTCTGCAACATTTCCTTTCTTTGGTGTGCAGCCGGTCATTGTTGATGAG
AAAGGACAGGAGATTGAAGGAGAATGTAGTGGATATCTTTGCATTAAAAAATCATGGCCTGGGGCTTTCCGGACCCTCTATGGAGATCATGACAGATATG
AGACGACATACTTCAAGCCATTTGCTGGCTACTATTTCACTGGTGATGGTTGCAGCAGGGACAAGGATGGTTACCACTGGCTTACTGGAAGAGTAGATGA
TGTTATCAACGTTAGTGGGCATCGAATTGGCACAGCAGAGGTTGAGTCTGCTTTGGTTTCGCATCCACAGTGTGCAGAGGCCGCTGTTGTTGGTGTTGAG
CATGAGGTCAAAGGTCAGGGAATATATGCTTTTGTAACTTTGGTGGATGGCGTTCCTTACAGTGAAGAACTACGAAAGAGCCTCATATCAAAAGTCCGCA
CTCAGATCGGGGCATTTGCAGCTCCAGACAGGATCCACTGGGCGCCGGGGCTCCCCAAGACCCGCAGCGGCAAGATCATGCGCAGGATCCTGCGCAAGAT
CGCTGCAAAGCAGCTGGATGAGCTCGGCGACATAAGCACTCTCGCTGACCCCGGCGTCGTCGACCAGCTGATTGCGCTCAAAGATTGCTAGGATGTAAAG
AAGTTATGCGACTGTTTTTTCCCCTATGTGGTTATGTGGTTGGTAGAAGGTTGGTTTTAGTGTTCATTGGTCTCCTTTTTAATTGGTGCAATTTTCTCCT
GAGGCTAGTGGACTGAAGCGAGGTGTAATGTAATGTTCTCTCCTTTTGTGCTTCACTTTTGTAAACTTGTGTCTCACATATCCGTAGAGTTGCGTGAATG
TATTGA
page-top