Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22696  (registered. 2003)
Contig Information
Length 711 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|21104591|dbj|BAB93184.1| unknown protein [Oryza sativa Japonica Group] >gi|113534192|dbj|BAF06575.1| Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|125528208|gb|EAY76322.1| hypothetical protein OsI_04255 [Oryza sativa Indica Group] >gi|125572471|gb|EAZ13986.1| hypothetical protein OsJ_003811 [Oryza sativa (japonica cultivar-group)]
Score 514
Evalue 1.98349e-50
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22696
TTTTTTTTTTGGATAATGGAATGTGTATAAATGCTCATCAAAAACCATTTCACATGAACAACACAGTACACATTACTGTCCTAATCCCTTGATGTTATAG
CATCCATCTATTTATCTAACCATGAGTGGGTCTGATGGTACAAAAGAAGTTCATCTGCCGAAGAGTTTGGAAAAGAAGTTTGTTGGTTTCGAGTTCTCTG
CGCACGCCACATGCATATATCTTCCTAGATTGTCAACTTGCCTTGGCTCCCCTCTTGTGTCTTTCTTGCAAACTTTGCAGGTCTTGTCCACCCAACCTTC
CTCCACGTATTCGCCGTCAACTTCAACATATGACTTGAAGAAATCCTTGTAGGTGCCACCAATCTTCCTCCGAAGGGCTGCATACTGTTCCCTTGTCATC
CTTCCTTCATCTTTGATGGAATCCCTGGCCTCATACAGCAGCTCCGCGTCCTTCTCCGACCGGACCTGCGAGAAGTCCAGCGCCTCGGTGATGTTCCCAA
ACAAGGACTGCTTGGGCACCTTCTTCTTCTCCTCCTCCTGCTCATCTGCTTTCGCATAGGCCCTAACTGATCTAGCAGGACTGGCGCTGCCTGGCTTGAA
GGAGGGCATGCTCTGGTGGAGCCCAAACGAGGAGCTCTGGGCCGGGGACAGCGCGAGCGCCCTCATGGCCATGGCTTTGATCAGCTGGTAGTTGGTTCTC
CTTCACCGCAG
page-top