Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22669  (registered. 2003)
Contig Information
Length 3195 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_005360 [Oryza sativa (japonica cultivar-group)]
Score 1972
Evalue 0
Total Hit Count 202
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22669
GGTTTGGACCACACCTTGCTGAAGCTGTTCCTTTGCTCATAAACTATTGTACAAGTGCATCAGAAAATGATGAAGAGCTCCGTGAGTACAGCTTGCAGGC
CCTTGAGAGTTTTATGCTCAGATGTCCAAGAGATATTTCCCCATATTGTGAGGGTATTTTGAATCTTGCTTTGGAATATGTAAGCTATGATCCTAATTTC
ACTGATAGCATGGAAGAGGATACTGATGATGAAGTACAGGATGAGGAAGAGGATGATGAGAGTGCGGATGAATACACAGATGATGAGGATGCAAGCTGGA
AGGTTCGCCGGGCATCAGCGAAGTGCCTATCTGCAATTATAGCATCTCGTCCTCAAATGTTGTCTAAGATGTATCAGGAGGCATGTCCAAAGTTAGTCGA
CCGCTTTAGGGAAAGAGAGGAGAATGTAAAGATGGACATCTTCAACACATTTATTGAGTTGTTACGCCAAACTGGTAATGTGACAAAAGGACAAGGTGAC
ATTGATGAGTCTAGCCCTAGATGGTTGCTGAAGCAAGAGGTACCCAAAGTTGTCAAGTCTATCAATAGGCAGTTGCGTGAAAAATCAATCAAGACAAAGG
TTGGAGCATTCTCAGTATTGAAGGAGCTTGTTGTTGTGTTACCAGATTGTCTTGCTGATCAGTTCGGGTCACTTGTTCCTGGGATTGAGAAGGCTTTGAA
TGATAAATCTTCTACGTCCAACCTGAAGATTGAGGCCCTTGCATTTACTAGGATTGTTATGGCTTCCCATTCACCCTCTGTGTTTCATCCATACATCCAG
GCACTTTCTGGTCCAATATTATCTGCTATTGGAGATAGGTATTACAAAGTCACCCGCTGAGGCTTTACGGGTGTGCGGGGAGCTGGTCCGGGTGCTCCGC
CCAAACTTTGAGGCACCTTCAATAGATTTTAGGCCATATATTATTCCAATCTATAAAGCTATATTGGCCCGCTTGGCGAATCAAGATCAAGATCAGGAAG
TTAAAGAGTGTGCCATATCATGCATGAGCCTTGTGATCGCCACTTTTGGTGATGGTCTTCAGAGGGAATTGCCTTCATGCCTTCCCATACTTGTTGATAG
GATGGGCAATGAAATTACACGACTTACAGCGGTCAAGGCATTTGCTGTGATTGCGAATTCACCTCTTCGTATTGATCTTTCATGTGTCTTGGACCATGTC
GTTTCTGAGCTCACAGCTTTCCTTCGAAAGGCCAACAGAGCCCTTAGGCAGGCAACATTGGGAACCCTAAATTCTCTGGTTGTCACATATGGGAGTCAAA
TTGGCTCGTCCTCTTATGAAACGATATTAGCTGAACTTTCTACTCTCATAAGTGACGGCGATTTGCATATGGCCGCTCTAGCATTGGAACTGTGTTGCAC
AATAATGGTCGACAGAAGATCCGTTAAAAATGTTGGTTTAGCTGTGAAACAAAAAGTTTTGCCTGAGGCCCTTACTTTGATCAGGAGTGCTCTGTTGCAA
GGACAAGCACTGCAGGCGCTACAGAAGTTTTTTGCTGCACTGGTCCAATCTGCAAATATAAGCTTTGAAACTTTGTTGAACTCCCTTATTTCTACTGCTA
AACCATCACAGTCAGGCGGTCTTTCCAAGCAGGCACTATTCTCTATTGCACAGTGTGTTGCTGTGCTATGCCTAGCAGCTGGTGATCAGAAGTGTGCATC
AACTATTGAAATGCTTAAAGGCATTCTTAATGATGACAGCTCTACTAATTCTGCTAAACAACACATGGCCTTGTTATGTTTGGGAGAAATTGGAAGAAGG
AAGGACCTCAGCAGTCATATTCAAATTGAGAACATCGTCATCGAATCATTCCAGTCACCTTTTGAGGAGATAAAGTCTGCAGCATCATATGCTCTTGGAA
ACATTGCTGTTGGCAATCTATCCAAGTATTTGCCATTTATCTTGGATCAGATTGACAATCAACAGAAGAAGCAGTATCTCTTGCTTCATTCACTGAAAGA
GGTAATTGCGCGACAGTCTGTTGATCATACTGGCCAGAGTGAGCTCCAGGACTCAAACATTGTGAAGATATTGGCATTGCTCTTTAACCACTGCGAAAGT
GAGGAGGAAGGAGTTCGGAATGTGGTTGCTGAGTGTTTAGGCAAAATTGCACTTATTGAACCTAACAAATTAATCCCTGCCCTGAAGGAACGCACAACTA
GCCCAGCAGCAAACACAAGGGCTACCAGTCGCCATTGCTATAAAATATTCAATCGTTGAACGGACTGGAAAGATAGATGCAATCTTGTACTCTGAGATTT
CTACTTTCCTTATGTTAATTAAAGATAGTGACAGGCATGTGCGACGTGCAGCTGTCCTTGCGTTGAGCACAGCTGCCCACAACAAGCCAAGTTTGATCAA
AGGTCTTCTTCCTGAATTACTGCCTCTTTTGTATGACCAGACTGTCGTGAAGCAAGAATTGATCAGGACCGTTGATTTAGGGCCTTTCAAGCATGTCGTT
GATGATGGGCTTGAGCTTAGGAAAGCTGCCTTTGAATGTGTGGACACATTGCTGGATAACTGTCTTGATCAAGTGAATCCGTCGTCCTTCATCGTTCCTT
TCCTCTTATCTGGCTTAGGTGATCATTATGATGTGAAAATGCCCTGCCATCTGATTCTCTCGAAGCTAGCAGACAAGTGCCCATCTGCTGTACTTGCAGT
TTTGGACTCACTAGTTGAACCTCTTGAGAAAACCATCGGTCACAAACCCAAGAGTGACGCAGTGAAGCAGGAGATTGATCGCAACGAAGACATGATTCGC
AGTGCTCTTCGAGCAATTGCTGCTGTAAACCGCATAAGTGGCAGCGACTACAGCATGAAGTTGAAGAATCTGATGAGCAAGATAACGGCCACTCCTTCAC
TTGCCGAGAAGTACAATTCAGTGCGCAGCGAATGAGTGCTGAATATTTTTCTGTATATATGTTAGGAAATAGGCGAGTCAAGTTGGCACACATACCTGCT
GGTTTCGAGGCGATGATCCAACCTAAATTTGCGATAGTAGATTGTACTGTACCGATTTTGGCTGAAATGTGGTCGTGCGGTAACTACCATGCGGAGAAAA
GGATGTTGAATATCTTTTTCTGTACAAAATATGGTTTTAGACCATTAGAAGCTGGTGTGGCAATTTAAAAATTGAAATCCATGCGTCTTTGGTGC
page-top