Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22646  (registered. 2003)
Contig Information
Length 897 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 6
Homology (BLAST) Top Hit putative glycine-rich RNA-binding protein 2 [Bambusa oldhamii]
Score 346
Evalue 9.15226e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22646
TATACTTGGAGAATTTATGATAATCAGACTAACATACACGACTTAACTCAGAGACTCACCACAAGTACACAGTGCAATATACGGCAAAATGCATGAACTT
CCATTGAGACTCATCCAAGCCTCGAAGCAGCATGACTTAAACTCTTGCACCATCAAGAAACGAACCAAAAACAAAAATACTAGAACCACATCTCTGCTCC
TATTGAGTTCAACTATCGCAGATAACAGACAGACGTGACATAGGTTCCACATAATCAAGACACTGTCCTAAAAGCGCATTATTTTAAATTTGATAGTCTG
CGCTCTCCTTAGAAAGCTTCACGGTCACCACCATAGCCACCGCCACCTCGGCCACCACCGCCATAGCCGCCGCCGCCACCACCATAGCCGCCGCCGCCGC
CAAAGCCACCACCTCCTCCATAGCCACCGCCGCCGCGTGAGAAGCCGCCACCACCCGAAGGCCTCTCATTGGCGAAGTTCACACGGACGTTCCTCCCTGC
AAGCTCCTGACCGTCCATGCCTTTTGCAGCGCTATCTGCATCAGCTTCATTCGCAAAGCTCACAAAACCAAACCCTCTAGACCTTCCAGTCTCTCGATCA
GTGATGACACGTGCCTCAACGACCTCTCCAAAGCTTTGGAACGCCTCCTTCAGCGAATGATCGTCAGTAGCCCAGGCCAGGCCGCCGACGAAAAGCTTAT
TGCCACCAGCGGGCTGGCCGGCGCACATGAAGCGGGCAGCGTTGAACAGGGCAGGAGCCGAGCCGGTCGAGGCACTGCTCGCCAAAGCACTCTGCCTAAG
AAGGCTTCCGAGCTTGATGAGGGCCGCCATGGAGGAAGACTAAAACCTCTGGAGGGCGAGCTGGGACGAGACGGCGTGGGAGGGGGGAATGGACCTC
page-top