Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22624  (registered. 2003)
Contig Information
Length 2258 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Homology (BLAST) Top Hit alpha tubulin-1D [Triticum aestivum] >gi|90289624|gb|ABD92944.1| alpha tubulin-1A [Triticum aestivum]
Score 1134
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22624
AGTTGAACATTTTGGTTTAATAGTACATCCCAATAAAGGACGACCATACTTGTTCAACTTATCTCTTTCAACTTGGATACCATGAGGCGGGCCTTGGAAA
GTTTTTGAATAAGTAGGGGGAATTCGTAGATCCTCCAAACGTAGAGCACGTAGGGCTTTGAAACCAAATACGTTACCTACAATGGAAGTAAACATGTTAG
TAACGGAACCCTCTTCAAATAGGTCTAATGGATAAGCTACATAACAGATCCATTGGCTGTCTTCCCCAGCAACAGGCTCGATGTGATAGCATCGTCCTTT
GTAACGATCAAGACTGGTAAGTCCATCAGTCCAAACAGTTGTCCATGTACCAGTAGAAGATTCGGCAGCTACTGCAGCCCCTGCTTCTTCGGGCGGAACC
CCAGGCTGAGGACTTACTCGGAATGCTGCCAAGATATCAGTATCCTTAGTTTCATACTCTGGGGTGTAGTAAGTCAATTTATAATCTTTAACACCAGCTT
TAAATCCAACACCTGCTTTAGTTTCTGTTTGTGGTGACATAAGTCCCTCCCTATAACTCTTGAATTCTCTCTCTCTCTGGAGGCCGTTCTTTACGCCTTC
CTGGGAAAAGAGCCGGGAGGAGGAGGAGGAGAAGGCGAGCAAGACGGAGGAAAGCGAGACGAGATGAGGGAGATCATCAGCATCCACATCGGCCAGGCCG
GGGATCCAGGTCGGCAACGCCTGCTGGGAGCTCTACTGCCTCGAGCACGGCATCCAGCAGGATGGCACCATGCCCAGTGATACCACGGTCGGGGTTGCAC
ACGATGCGTTCAACACGTTCTTCAGTGAGACCGGTGCGGGCAAGCATGTGCCGAGGGCCATCTTTGTCGACCTTGAGCCCACTGTCATCGATGAGGTGCG
CACCGGTGCGTACCGCCAGCTCTTCCACCCGGAGCAGCTCATCTCTGGCAAGGAGGATGCCGCTAACAACTTCGCCCGTGGCCACTACACTGTTGGAAAG
GAGATTGTAGATCTATGTCTGGATCGTGTACGCAAATTGGCAGACAATTGCACCGGGCTGCAGGGATTCTTGGTGTTCAATGCTGTCGGTGGTGGAACTG
GATCAGGACTGGGCTCTCTGTTGTTGGAGCGCCTCTCGGTTGATTATGGCAAGAAATCTAAGCTTGGTTTCACCATTTACCCTTCCCCGCAGGTCTCGAC
AGCTGTTGTGGAACCATACAACAGTGTCCTCTCCACTCACTCTTTGCTTGAGCACACCGACGTTGCGGGTCCTCCTAGATAACGAGGCTATCTATGACAT
ATGCCGGAGGTCTCTTGACATCGAGAGGCCAACCTACACCAACTTGAACAGGCTGATATCACAGATCATATCCTCACTTACCACCTCGCTGAGGTTCGAT
GGTGCCATCAATGTGGATGTCACAGAGTTCCAGACCAACCTCGTCCCTTACCCACGTATCCATTTCATGCTTTCGTCGTATGCCCCTGTTATCTCTGCCG
AGAAGGCTTACCATGAGCAGCTCTCTGTGCCTGAAATCACCAATGCTGTCTTTGAGCCCTCAAGCATGATGGCCAAGTGTGACCCTAGGCATGGCAAATA
TATGGCCTGCTGCTTGATGTACCGTGGTGATGTTGTTCCCAAGGACGTCAATGCCGCAGTCGCAACCATCAAAACCAAGAGAACTGTCCAGTTCGTCGAC
TGGTGCCCTACCGGGTTCAAGTGTGGCATCAACTACCAGCCACCCTCCGTTGTCCCCGGCGGCGACCTGGCAAAGGTTCAGCGGGCCGTGTGCATGATCA
GCAACAACACTGCCGTTGCCGAAGTGTTCTCGCGCATCGACCACAAGTTCGACTTGATGTACGCCAAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGG
CATGGAGGAAGGTGAGTTCTCGGAGGCCCGTGAGGACTTGGCCGCTCTCGAGAAGGACTACGAGGAGGTTGGCGCCGAAGGCGCAGACGATGAGGGCGAC
GAGGGGGATGACTACTAAGTAGCTGGTTAATAAGTAGTTGGCTGGTTAATGATTGGCTTTGATCTGTATACTCAGTAAGTATGGTTCCATTGCGTTACAT
ATTGATTGCTGTTATGCGTGTTTCCTTTTCTTGTAATGTACTGAAGTTGTTGTTAGGGTGGCCATGATTGTTGATACCCCATTTCCTCATTTTGGCTTTC
GATGCTACTCGTCCCATGTTTGGTGTGTGTGCATCATTCTGAGCCGAACTGCAAATAT
page-top