Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22610  (registered. 2003)
Contig Information
Length 1054 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit Os05g0535700 [Oryza sativa (japonica cultivar-group)] >gi|47900417|gb|AAT39211.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579709|dbj|BAF18072.1| Os05g0535700 [Oryza sativa (japonica cultivar-group)] >gi|215692606|dbj|BAG88026.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692940|dbj|BAG88360.1| unnamed protein product [Oryza sativa Japonica Group]
Score 225
Evalue 1.27563e-16
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22610
GAATTTTCAGGCCATGAGGTCAAATATTGTCCCGCATGTTTCTCGAATACATTATGTCCCCCATGGTTGTTTCCCAAGCATACACGTCCCATGCATAACA
TACGTCATTCAAGGACACGATGTAATGGATTATTTATTGATAACATGAAGTGCACTTAGCATATCCATTAAGCTCTATCCATCAACGCAAACCTTGCAGG
TGCACTTGGCAAAGAAAAAATTACTGCACCAATGTTCGCGGATCTCCTGCCCAGGGTAACCGAAACGACCCACGCATACAGACTTGCAAATACCCTTGGT
ACAAAACAACAGCCGATAAAACCCAGAAGTCAAACATTTCTCTGCAGATGTAGTGCTTCCGAACAACACAAGCATCACCAAAAAACAAGCGGTGGCAGAC
CTTCCATCCATTCTTGAATTACGCGCTCCAACGAGAGCCAAAGGATCAATCAAGCCTTTAAAAAGCCTCGTGCCGAATTCGGCACGAGGAAGGAAGGAAG
GGGAACCAAGGAGCGCAAGCAAGAGGCGGCGAGGCGGAGGAGGATGGGGTTCATGCTGCGGGTGAGGCTGGCCTCCTTCTTCGCGGGCGCGGCCGCCGCG
GCGGCGGGCGGCGGCTACTTCCTCTACAAGGACTACAAGCTCGCCCACGACTCCACGGCCCTCCAGGTGAAAGGTCTGCATGACCACGTGGACGCCCGTT
ACAAGGCTCTCGACAAGCGGCTTGCAGCTTTGGAGGCCCAGAAAAGCGTCGACTCCTCTCCGGCTGTGGACGCGCCATCGGGCTAGTCGTCCGTCTGTCC
ATCACGAGGCTTGACAAGTGGATGATTCTAAGTCTGTTTACTTTAACATGCGCGCGCTATCTGCTTCTCCTTTGAAGGCAAGGGGCCTGTGACTGACAGC
GAAATAATATAGCGAACGGTTTTTGTTTTGTTGTGTGGGCAAGAAGAAGCTCCTTTTGTTGCTTGAGGGGATGCATCAGACCTTTGCACACCATTTTGCA
CTTGCTGTCGCTTATCCTGGGGATTCAACCCGAACCCTTTATCGAAAAAAAAAA
page-top