Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22594  (registered. 2003)
Contig Information
Length 1233 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit glucose and ribitol dehydrogenase homolog - barley
Score 1471
Evalue 5.31374e-161
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22594
TTTTTTTTTTCAGCTTGCATTGCATGCACGCACGTTACATTATTTATTTAACGCTCGACACTTCCAAGTGGCTATAGCGCCAAAAGCCCCTACCGAACTA
CTACCAGCTGACACTCGAGACTCGACGCGCCACACTTGCTCGTACAGACCACACACCACGGGCACACTTCACTCTCTTCTTCGCGAGCTTCTCCATCCTC
GATCTAGCTATTGACGATGGTACCACCATTGGGGTGGAGGATCTGGCCGGAGATGTAGGAGGAGTCCTGCTCGCTGGCCAGGAAGACGAAGCTGGGCGCG
ACCTCGCTGGGCTGCCCCGCGCGCTTCATGGGCACCTCGGATCCAAACTGCTTCACCTTCTCCTCCGGGAAGGAGGCCGGGATGAGCGGCGTCCAGATGG
GCCCCGGCGCCACGCCGTTGACGCGGATCTCCTTCTCCGCCAGCTGCATCGACAGCGCGCGGGTGAAGGCCACGATGGCGCCCTTGGTGGCCGTGTAGTC
CAGCAGCGTCGCGTTGCCCTTGTACGCGTTCACGGAGGTGGTGTTGATGATGCTGGACCCGGGCCCCATGTGCTTCACCGCGAACTTGGCCATGAGGAAG
TAGGAGAAGATGTTGGTGCGGAACACGCGCTCCAGGTCCTGCTCGCTGATCTCGGTGATGCAGGGCCGGACGTACTGCTCCGCCGCGTTGTTGACGAGGA
TGTCCACGCGCCCGCCGTGCGCGTTCGCCACCTCCTCCACCACCCTGCGGCAGTTCTCCTCGTACCCGAGGTCGCCCGGGAGCGCCTTGGGCTCGCCGGC
GCCCGTGCGGGACTTGATGTCGCGAAGCGCCTGTAGGGTCTCCTCCGCGTCCTTGTCCTCGTGCCCCTTCACGTACGTGAAGTTCACCGTCGCGCCCTCC
AGCGCGAAGCACAGGCACACCGCGCGCCCGATGCCCGAGTCGCCGCCGGTCACCAGTGCCACCTTGCCCTGGAGCTTGTTGGCCGACTTGTAGTTCTTGA
TGAGGGTCTCGGGGCGGGGGTCCATGGCGTGCTCCTTGCCGGGCTGGCAGTCCTGCTGCTGCGGCGGGAACTTCTGCGACGCCATCGCTCTGGTCCCTCG
GCGAGTGGGCGGTGCTCTTGGTGACGACGCGGCGAACGAAGCTAGCGCTCTGGTGGCGGGGAGGGGACGCAGCTGATTCGGTCGGAGGCGGTGAAGAAGA
AGGAGAAACGGCTGGGCTCTGGTGGGTGTGCGA
page-top