Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22590  (registered. 2003)
Contig Information
Length 2566 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit hypothetical protein OsI_24056 [Oryza sativa Indica Group]
Score 1910
Evalue 0
Total Hit Count 497
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22590
TTTTTTTTTTAAATTCTTCTGTAATACAGTGCGGTATTTCTATACTTATATCTGAAAGCAGTGCAGTTAACAACTTACAAGGTCAAAGCTCACCGTCACC
AAAAAGTTGGAAAAGAAGAAAAGCAAAGGTCACACGAGCACATTGCATGCCTTTACATTAACTTCGATTTGCAAAAATACCACAGCGATCAGCATCGTTT
CACTACTCTAGCGAGATGCGCCGGATCTTGGAGACGAGATGGGCGGTGGGGAGGTCCAGCTGGGTTCCGCCGTCCGATTTTATCAGGTCGCGGACCTGGT
CCCTCGGGGTCGAGATGCAGGCGTGGAAAGTGGACAGGAACGGAGGGATCGGCATCGACAGCGCCGAGAGGACGTTGTTCAGGTACTCGATGTCCGCCGC
GAGCTGCTGGGCGCCCCGGTCCGTGATGTAGTGGATCCCGCGCAGCTGCTCCATGAACAGAGCGGTAGCACCCTCGGCAACCTTGAATATCCACTCTGTA
GCAAAGAACTGAGCCTCGTCGTTGCCAGCCTCACTGCCTGAGATGCCTTCAGCGAGAGGCTCCAACTGCTGTGGCAAAGTGAGGAGATACTCCCCGACAC
TGGTCACGTACGCCTGTGGGTACGCACTGAAGCTTGGAAGAGGAAGACCACCCTGCTCCTCCACGGACGACCAGATTGGGAGGCGAGCAATCTCACTGAG
ACGCTGCCGGACTTTGGAAATGAGCACATCATATACAAGCTCGTTTACTTTGTCTGAGAAAGCCGCAACTCTTTGTGACGTGACGGGAAGAGCGTGGAAC
CTTGGATCTTTTGACTGTTCTAGCACAGTGAGGAGTTTCTTAAACTTGTCTGGTAGATTGGTGAGTCGAATGGTTGCAATATCAAGTGCTGCCCTCCCAC
CCAGAGGTGCTCCCGAGTTGTCATCAGCGGTACCAGCAGATAATTTATCCATGCTAGAACCAAATCCGGAAAGAGAAAAGTTTGTTCCAATCCTGGCAAG
AGTAGCCCTTAAAGAAGCTTCGAAAACTGAGGTCCTGCTAGTTAAGCAATCGGCAACTGTAAGAACCTGCAAAGCACCCTGGACAATTGACCATTCTTCC
TCTTCAGACACATCCACCAATCGTGGTGCTTCCTTTTTCTCTAACCCTGCATCTTTTTTCAAGGCATCAGTATGTGTGGTATTATCCAACCCACATACCA
TCCTCAGGGACTTCAAAGTTTCTTGTAGATTAGATATGTATTGCAGCATGACGTCATCAAGAGCCAGTACCAGTTCATCTGCCTCTGATCCACCAGTGAG
ACTAATGCATCTCTCAACAGCTGCTTCAAGAAGTACTATCATCTGTGGGATGGATTCCTCCATCCTACGGACAGTTTCACTTAGCTCTATACCTTGTGCA
CCTAAACCACGGGAGATGGCTCCACGGATATCTATACCGGCCATCGCAGCAGAAAGCACAGCGCGCTCCATCTGCCCCTCGTGCCGAATTCGGCACGAGG
CTCCTATGCGTTACGTTGATATTGGCATTCCTGCTAACAACAAGGGGAAGCAGAGCATTGGTTGCCTATTTTGGCTGCTCGCCAGGATGGTTCTGCAGAT
GCGTGGTACCATTCTCCCAGGACACAAGTGGGAAATCATGGTTGATCTGTTCTTCTACAGGGACCCAGAGGAAGCTAAGGAGCTTGAGGAAGATGAAGCT
TTGGGTGCTCCTGAGTACGCTGCAGTTGCAGAGTACACTGCCCCAGCAGGGGATACCTGGGGTGCTGAATGGCCAGGAGCTGCAGCTCCAGCTGCTGCCG
CCGAAGCCCCGGCTGGGGCCGAGTGGACTGGTGCTCCAGGTTTGAATGAAGATTCTTATTTTGTAATTGCATAATTAGATTGGAACTTTATGAACAACCT
CTAGTCTCAGTTTCAGCCCACATTTGAGATCAACCTGCCGTCCTAGTTTATTCTAGTATAATTTTATCTCTATATGGTCTTTCCTTTATCTGGGGATAGT
AAGTTTTCAAGTTTGTTCACATTGAATTCATACCCCATTTCTTATCCTACCCTTTTACCAGATGCCATTTGCTATTCTGTCCTTTCTTTTTCTGTCTCTG
CCTATCAGTTTGACTATTTTTTTAGCCTGAAATGTTCAAATTGTACTCAAATTACATTTCTGAATTTCAGCTCCTGCTGCCGATGGATGGGATGCAGTTC
CAGCACCTGCCCCTACTGGCTGGGAACAGGGCAGCGCTCCCGCACCCGCAGCAGCACCAGCTGCTACTCCGAACTGGGAGTGAAGGACTTGACCCAAGGT
TTATGCTACTCGGCACTGTGGAGTGAAGGAGTTCGGCCGCGGTTTATGGGTGAAGGCTGTGTTATTTGCCCCCGTCAGTACTTTGTTGGTAGACGCTGGT
TAAGTAGATTTAATTTTTACAGTACTGAGTTATGTTAGATGGAAATCGATTTTTGTCTTCTTGGCTTTGCAGGGGTTGGGAGTTATCGCCCCAGCCTTCT
GTTGCCTCTCATCGAATAGCTTTATTTGAAGTTCCATTTTGCCAGCAAGTGTATGGTCAGATCTCT
page-top