Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22526  (registered. 2003)
Contig Information
Length 939 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsJ_006744 [Oryza sativa (japonica cultivar-group)]
Score 786
Evalue 9.46648e-82
Total Hit Count 337
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22526
ATAACAACAACAGAGGACAGCAGTAAAGTCACTTTATTTGGTACATTAAAGTTCCAAACCTGAATTTAATTTCCATTTGACTGCAATCCTCGGTATTATA
TGTTCTGTCTCTACAAAGAAGAAACGCAGTCCACAAAGGACACAGACCTTATTGAGCTTAGGGAAAAACAATGTATATAGTTCTCTTCTAATTGCATAAA
TATAGTCTTCTCTCTCTCACTAGTTTTCATATATAAGCTCTCGACTGAGTTCCGCTCGGTGTCCAAAACTTTCATATCTAAACCATGACTGCGCCAGTGC
CTTCTCTCATCTACCGACGCGGCGGGGGTCTCCTCCCGCCTGGAGCTTGATCTTCCTCGTCGGATTCGACGTCTCCATACTGCCACAGCCGCAGCCTTTC
CTTCTTCGCCTTCTCCTGGAACTGTTCCAGGTTCTCGAGAGCTGTCTTCCTCTCCTTGGTGTCCCATCTCTTGCCCCTTTCAAGTCGGGCAAGCCCTTCC
TCGAGCATGGCAGCATTGATGCTGGATTCTGTCTCTGGATCAACAAGAGTCACAATGAGTACAGGTCCAGTGCCTTGTCCCTTCACTTTACCACCAGTAG
TGTCGCGCTCTTCGATCATTGCCCGGTATTGTTTTGAACTGCTCAGCAAGCATTCGCTGAGATACTCTGCTGCTTCCTGACCATTATCATCCTCCAGACC
AGGCACCTTTATGAAGGCAAGGCTGCAGAGCTGAGCAAGAGGAGGAGAGGAGGATACTGATGGGTCTGCAGGCCGGATGCGGTTGTAAGGAACCACTTCT
TGGTTGCCAAAATCAATGTAGAATACTTCAAATTTGTCATCTACAGACTCTACAGCTCCTCGGGGTCCATTAACAATCATGGCTCTATTCCAAGAGTTGT
CGAGGCTAAACTGAGCAAGGAACTATCTCTCCCTTCCCA
page-top