Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22505  (registered. 2003)
Contig Information
Length 1116 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit HAP3 [Oryza sativa Japonica Group]
Score 679
Evalue 3.1626e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22505
TTTTTTTTTTGAGGGGGACGCGATCAGCTCCCCTTCCAGACATGGCAAAGAGAGGTTTACAACTCAGTTGGCTTGCATGTTGCATCACAAGTCGATGTCT
GTTTGGCGAGCCTTACACCCCGGAGCGGGCGCAAGAAACACCGCACAACTATAAGTTAATACCCAGTTGTAATATATTTATGCTTCCTAATACAAATATC
TGAAACAAAAGATTGCCAAACTACCAACGGCTGAATTATTCTGAATGTACAGATAAAAACAAGCACTAAACCATAATAGGTGAATCTATTCTCTCGGAAG
CAATTTACATCTTGGAGGCAGCCATCACAACCAACTGTTAAGCACCCTTCCAGGTGCTTTAGTTTCCAGCCAATGATCATCATGAACCTAATGTTGGGGC
GGCTTCCTTAACAGATAGATAACCACTCATGGAGCAATACCCATTGCCGAAAATTGCCTGATCTTCAGTTTCAGGTGTCCCCATTATGGTACTGGGGTTG
CATATAACCCATCCCTTGGGCGTAAGCTCCATGCTGAACCATCGCTTGGGCGTTTGAGCTAGTCGCACCACTATGAGCACCAATTATATCTTTCTTCACG
GATCCTTCACCAGATTTTGAGGTCAATTTACTATCACCCTCCATATCTCTGTACTTTTGCAGGTAGATCTTGAGGGGGTCTACGTACTCCTCGAATCCGA
GCGTGGCCATGGCCCAGAGCAGATCGTCCCCGTTGATGGTCTTGCGCTTCTCCTTCTGGCACTTGTCGCTGGCCTCGCTGGTGACGAAGGAGATGAACTC
GGAGACGCACTCCTGGAGGGTCTCCTTGGCGTCCTTGGCGATCTTGCCGTTGGCCGGCACGGCCTTCTTCATGATGCGGCTGATGTTGGCGATGGGGAGG
AAGCGGTCCTGCTCCCTGACCCCGCCGCCGCCCCGGGGGCTCCCGCTGTCGTCGTCGGCCATCCCGCGCCCCGAAACCCTTATAAAAACGCGCGCGCGGG
GGGGGAGGAGCGGAGGGGAGAGAAGGGAGGGGGGAGGAGGAGACGGTGGTTGGCGCTGCGAGGAGGGGTGGGGAATGCGAGATCGGACGCTGGAGAAGGC
GACGCGGCCCGGGCCG
page-top