Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22487  (registered. 2003)
Contig Information
Length 679 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit RecName: Full=Histone H2B.9 >gi|152032521|sp|A2Y7R3|H2B9_ORYSI RecName: Full=Histone H2B.9 >gi|50080248|gb|AAT69583.1| putative histone H2B [Oryza sativa (japonica cultivar-group)] >gi|52353547|gb|AAU44113.1| putative histone H2B [Oryza sativa (japonica cultivar-group)] >gi|125553414|gb|EAY99123.1| hypothetical protein OsI_21083 [Oryza sativa Indica Group] >gi|125595303|gb|EAZ35362.1| hypothetical protein OsJ_018845 [Oryza sativa (japonica cultivar-group)]
Score 469
Evalue 2.98178e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22487
TTTTTTTTTTGAACTCTGAAGCGACACGCAAGCACACACGAACATTGATTTAAACAGCAACATCACTGTTTCTTCAGTCCCACAAGCAAGCAGCACAATT
CTTACAAAGGTTGTAACATCATACTACTGCCAACTACATACACGATGCCTGCCGCCATCAACTCATGAAACGACGACGACGAAGCCAGCCTAGGATGATG
TGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGAT
GGTGGGCTTCTTGTTGTACCTCGCCAGCTTGGCGGACTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAG
GAGATGCCGACGTCCGGGTGCACCTGCTTGAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCCCTTCTTGGCCTTGCTGCCCTTCTTCCGGCCCC
TCGTCTTGCCCTCGCCGCCGGCCTCCTTGGTCGCCGGCGCCCGCTTCTCCGCCTTGGGCTTCTTCCCCGCCGTCGTCTTCTCTGCCGTGGCCGGCGCCAG
CTTCTTCTCTGCCGCCTTGGGTGCCATGGGTGCTGCTTCTGGTGGTGGTGGTTCGAACGTGTGGAGGTGTGGGATGTGA
page-top