Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22482  (registered. 2003)
Contig Information
Length 724 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Os01g0805000 [Oryza sativa (japonica cultivar-group)] >gi|55296824|dbj|BAD68168.1| putative plastid ribosomal protein L34 precursor [Oryza sativa Japonica Group] >gi|113534087|dbj|BAF06470.1| Os01g0805000 [Oryza sativa (japonica cultivar-group)] >gi|125528074|gb|EAY76188.1| hypothetical protein OsI_04121 [Oryza sativa Indica Group] >gi|125572355|gb|EAZ13870.1| hypothetical protein OsJ_003695 [Oryza sativa (japonica cultivar-group)]
Score 292
Evalue 1.13733e-24
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22482
CTCCAACTGCCCAGACATGGCGCTTGCCCTCGCCTCCCCAATGGCGTCCCTCTCGCTCCACTCCGGGAGGATCTCGGCGCTGGCTATCGGCGGCGGTCTC
CGCCCCCACAAGGCGGGCCCTATGGGGGCCTCCGCATCCCCGTTTCTCCGGAGCTCATTCATCTCCTCTTCCTCCACCTCCTCCGCCCCCACCTCCTCGC
TCTCGGCTGCGGTCTCGGCGTCGCTCGCCTTCACGTCCGCCTCCTCGTTCGGCGGTTCATCTTTGGGAATTGAGTTCAGCTACAACAGATTAACAACACG
CAGACCCCGCGGTCTACAGATTAGGGCTGGAAAGGCTGCCCTCTGCCTGACCAAGAGGTCAAGATCTAGGAAGTCACTTGCCCGTGTGCATGGTTTCCGA
AAGCGGATGCGGACTACTGCTGGAAGAAAGGTTCTGAAGCGTAGACGTGACAGAGGAAGGAAGATTCTCTGCACAAAGTCGAACTCACCCACTGGGACAA
AGTATTGATTACAGCGCAATGTGAGGCATTATGTATTCCAGCTGTAAGTTTACTCTTTTTGCACCCCATGTTCTCAGCCATGTTCATCTGTAACAATTGC
TGCACATCTTTTCCCTGTACTTTGGTTAATAACTTGATATCTGAACTAAATTCCGACACTCGTGTAATTTATCCTTTTTGGTTGTGGCAGTCTTTAATGC
TATGTTGTTTTGTGAAAAAAAAAA
page-top