Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7589  (registered. 2012)
Contig Information
Length 1126 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115488340|ref|NP_001066657.1|| Os12g0420200 [Oryza sativa (japonica cultivar-group)]
Score 634
Evalue 5.00E-180
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7589
AAACAAAGCCCTCTCCTCTTGTTTGCGCATCGTATTTTCAGTAGCACAAGCTCAGGGAGAGGGGAGAGAGATGGCGGCGGCAAGCGTCTCCCTGAAGAGC
AGCCTCTTCCTGTCTTCCCCTCTTTCCGACTTCGGCGGCGCGGCCATCTCCATCTCGGCCCAGAATAGGAGAAGGTCATGGCAGCCAAGGGGGGCGAGAA
TGCAGGTGGCAGCAGCTGCAGACTCCAAGAACATTCTCATCATGGGAGGCACCAGGTTCATCGGCCTCTTCCTGTCCAGGAAACTTGTCCAGGAGGGACA
CCAGGTGACATTGTTCACCAGAGGAAAGGCACCCATAACCCAGCAGTTGCCAGGTGAATCAGATGCAGAGTATGCAGAGTTCTCTTCCAAGGTGCTGCAT
TTGAAAGGTGATAGGAAAGACTTTGATTTCGTGAAAACCAGCCTTGCTGCTAAGGGCTTCAATGTCGTCTATGATATTAATGGGCGCGAGGCCACTGAAG
TATCCCCCATACTAGAAGCGTTGCCGAATCTGGAACAGTTTATCTATTGCTCATCGGCAGGAGTCTACCTTAAATCAGACCTGCTCCCACACTTTGAGAC
CGACGCCGTGGACCCGAAAAGCCGGCACAAGGGAAAGCTGGAGACGGAGAGCCTGCTGGAGACGAGCGGCGTGAACTGGACGTCCATCAGGCCGGTCTAC
ATCTACGGCCCTCTCAACTACAACCCCGTGGAGGAGTGGTTCTTCCACCGGCTCAAGGCTGGTCGCCCGATCCCCATCCCTAACGCCGGGAACCAGATCA
CCCAGCTCGGCCACGTCAAGGATTTGGCGACGGCCTTCATCAAGGTCCTCGGCAACCCCAAGGCGAGCAAGCAGGTGTACAACATCTCTGGCAGCAAGTA
CGTCACCTTCGACGGGCTAGCACGGGCATGCGCAAAGGCTGGAGGGTTCCCTGAGCCGGAGATCATCCACTACAACCCCAAGGACTTCGATTTCGGCAAG
AAGANNNCCTTCCCCTTCAGAGACCAGCATTTCTTCGCGTCGGTGGAGANNNNCAGCAAGGACCTCGGGGTTACACCGGAGTACGACCTCCTCGACGGCT
TGACGGACTCCTACAACCTCGACTTC
page-top