Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7587  (registered. 2012)
Contig Information
Length 1250 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|50509325|dbj|BAD30783.1|| putative SHOOT1 protein [Oryza sativa Japonica Group]
Score 486
Evalue 2.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7587
CCCCTTACCGCAAAGATTCAATTCGCAGAGGAACCAAGAGCCCAAAGCTCCCAGCTAGCTAGCTGAAATGGCTCTCGCCCACCAGATCACCAACCAGCCG
CTCCTCTCCTCCCCGCCGTGCCTCGCAAGAACCAACGGTAGCAATGCGCGGACGGCGAGGACGGCGTTTCTTGGCCACAGCTGCTGCCTGAAGCTTCGGG
ATACAGCGACGAGATGCGTCGTCGCTTCGTCAGCGCAGGCGGAGCCCAAGTCCGGAGGTGGGGACGGGGATGGAGGCCAGGAGCCGTACGAGGAGTACGA
AGTGGAGATCCTGAAGCCGTACGGGCTCAAGTTCGCCAAGGGCCGCGACGGCGGCACCTACATCGAGGCCATCTTCCCCGGCTCCTCCGCCGAGCAGACC
GGCAAGTTCACCGTCGGCGACAAGGTTATTGCCACCAGCGCCGTCTTTGGAGAGGAAATCTGGCCGGCGGCAGGGTACGGCCAGACCATGTACTGCATCC
GCCAGAGAGTTGGCCCTCTCTACATGAAGATGCAGAAGAAATTTGGGAAATGGGATGGTGCTGCTGAGCTCTCTGACAAGGAGGTCATCAGGGCTGAAAG
GAACACCGGAAATGTCAGCACTAAACTCAGAGAGATTCAGATGCAAAATTACCAGAAGAAGATGGAGCAGAAGATCCAAAGAGAAGATGACCTTCGCATG
GGGCTAAAGTTGTACAAGGATGAAAAATACGAGGAGGCGTTGGAGAAGTTTGAGTCGGTGCTGGGGTCAAAACCAGAGATTGATGAAGCTTCCGTAGCCA
GCTACAATGTCGCGTGCTGTTATTCGAAGCTCGACCGGATACAAGCTGGCCTTTCTGCACTTGAAGAAGCGATGAAAGCAGGCTATGAAGACTTCAAGAG
GATTCGCACCGACCCGGATTTAGCAAACTTGAGGAACTCGGAGGAGTTCGCCACCCTACTAAACAAGTACGATGAATCATTTATCAACGAGAGCGCCATC
AATGCTATCAAATCCATATTTGGATTCGGTAAGAAGTGATGACCTCCTATCGATTGCACACATCTACTTGGTCTTGCAGTTTGCACACTTGGCCATACAG
CCCAGCCTCTNNNNCTCTCTCTCTCTCCCCCACTAGTTCGAAACAGTAGTTTTAGTTTGTTCTTGCAGAGACTTGGGAGATATCTCNNNNNATGGTTTTA
GCCTTCCTTTGTACTTAAACCATTCTATGAACATACACTTTGTACATAAC
page-top