Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22418  (registered. 2003)
Contig Information
Length 831 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 12
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 1232
Evalue 1.46727e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22418
CATCTGCACAAGGAGTATCCCTGCCGGCTCACAATAAAAGCCATGCCTGAGCCGTCTGCGATGAGCCTTTTGTAGTGTAATGGTTGTGATTGTTCTTAAT
GTCTAAATACTCTCTGACTAGTCAATGGTAGCAGTTGCATCAAGCATAATCTGGCATGAACTTCTTAAGGAATCTTATTGGTTGAGATTCCTCAGGCACG
AGCTCGTCAAAAGAAACGTAGTATCTCTCTTTGTCATACACATGGCATGTAGTCAATATTGTCTTCATCAACCGCCAATTCCAGCTGGCCTCATTGATAT
ACTTGCCCCAGTTCTGTTTAATGGAGTCGTGGGCAGCACGAAGGTTATAACTTGGAATTCTTGGAGAAATATGGTGCGGGACGTGTACATTTATGTCATG
GCAAAGGATCTCTATCCATCGAGGATAGCTACAGTGAACTGTGCCGTTTAATTGCGCCTGTGCAGCATTCCACTCTTTTGATGATTTGAAAGGTATATGA
GGAGCAGTGTGATGCACCATTGTAAAGGTGCTCATCCAAAAGTGATAAACCATCCATGGCATGAACCAGAACTTGAACCATCCAGCTATTCCTGATTGAA
GAATGATTAGGGGCCATCCAATTGCCATGAATGCAAAGACACACGCCAAACTTATCTTCACCCTAGGGAGTTCATTTGGCCGGAATTTTTTTAGATCAAA
GTGCCACATCAACCAGTGAGCAATAGACATCCATGGCCTGATAGGACCATAACCAAATATAATTGCCTTCCTTAGGAAAGAAGACGATTCAATTTCNTTT
TGCCAAACAGGTTGCCATGCAGTATCTTCTA
page-top