Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22413  (registered. 2003)
Contig Information
Length 1281 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 6
Homology (BLAST) Top Hit biogenesis protein [Hordeum vulgare subsp. vulgare]
Score 1398
Evalue 1.62691e-152
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22413
CTTTTCTGTGGACTGCTGAGATCAAGATGTTTAAGTTACCGTAAACATATTTGCATTCCTATAAAAGCTAGAAATAACTGATGCTACTTCCTTGCCATTT
ATGTTTAGCTACTTTACATCGCAAGACATGTTGGCATGTGCAACAATGGTGATCCTTGTCTAGCGGCTCTTGTTCAGCAATGGCCTACAACTCTACAGTT
CACATCACCATTGATGTCGCAGGGAACAGCTTGTCCAGTAGGGTATAAACACCTCCACCCAATAGAAATGCACCACTGATGGGGTTTATCCATGTGGAAT
ATCTTCTGAATGACAGCAAACTCTGCAATGCTCCAGCAAAAGAGGCTGCAATGAGAAGAGGTGCAACATAGCCAGTTGTATATGTCAACAACAAACTTCC
CCCAACAATTGGATCTCTTGAAGTGGCAACATATCCCAGAAGGGTAGCAAGAACAGGTGTACTGCAAGGTGATGCTGCTAATGCAAATGTAAGGCCAGCA
AGATATGCTTGTACACTGGAAGGCAAGTTAGCTGCAGCAGCTCGAGGATCATAATCGCTGAAAAATGAGGGAAGTTGTAGCTCAACTACCTCAAGTAGGT
TCAGTCCCATGACGATTCCTAACCCAGAAGCAGCCACTGGGAGTCCTTGTCCTACTTGCCCATAAGCCTTTCCAGCAAAAGAAGCAGCAACACCAAGGAT
GGCTAAGGTTGTTGCCAGTCCTAATGAGAAAGCAACTGAATTTCCAACAACCTCAGCTCGATCTTTTCCAGAGCCAAAGGCACCTATATATCCTAGAGTC
AATGGCAGAACACTGAGTGTACAGGGAGACAAACTAGTTACAAGTCCAGCACCAAAAATTACTGCCAAGCTGGTGAAACTGAGAGCAGACAACTGATCCA
GAACAGCCTCATTAGCTTGCTGCCCAGCTGAAAACAATAAACCTCCAAACCAATCTCCGATGCCTAAGTCAGCCAAGAGAAGTCCCAATGATCCTAGCAG
AGAATCCCCGAGGTCGGCAGCATTCGCAGCCCCAGCAGCAACCAGACTTCCCACGGCTACACATGACAGCACGATCGGGCGCGGGCGGAGGAGCGACCGC
CTCACCACGGCCCCCGGCCTGGCTCCACGAGTCTCTGTCGTAGGCGAGGAGGATGGGGTGGGGTTAGCAGCTCGCGCTGGGAGGTGTGGGCGGCGGGAGA
CCACGGGGCGGGTGCTCATGGCGACGGAGAGCATGGCGGGAGGGCGGGATGTTGTCGAGCAGAGGAGAGTGGAGAAAAAGT
page-top