Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22407  (registered. 2003)
Contig Information
Length 547 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 5
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Acyl-CoA-binding protein [Panax ginseng]
Score 280
Evalue 1.45958e-23
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22407
AGAAGACATGTAGGAGTATTAATCAATCATGGTGTAAACTGAGATTGCACTTTCATGTATCACAGGGCTTGTTCAACGTAATTACACCCACGACGGCGAT
AAGCTTGACAACAACTAGTACTTGAAACTTATTTGTGTTTGCTGGCACATATGGCTGCACCACCAGGATAACAATAGCGATTGCGGTTTTGTGGCCTGGG
ATCAAGCAGATGCGGCAGCAGCCTCCTCCAGCAGCTGCTTCACCTTGGTGATGTAGTCAGCCATGGCCTCCTCCTTGGATTTGGCTTCGACGGCCTTCCA
AGCATCCCACTTGGCCTTGCCAGCCATATCAAAGAGGCCGCCGGGGCGGGCGGTGTTGACGGGGCCGACGGTGGCCTGCTTGTAGAGGCCGTAGAGGCAG
AGCTTGCTCTCGTTGGTGGTGGTGTCGGGCAGCGTCTTGGCCTTCTCCGCGTGCTCCTCAAACTCCTCCTTGAGACCCATGTCGATCGTCTGCTCTCCTC
GGCTTCGATACGTTCGAGGCGATCGATGCGATGCGATGCGAGGCGAG
page-top