Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22398  (registered. 2003)
Contig Information
Length 1432 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit putative cellulose synthase [Triticum aestivum]
Score 1932
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22398
AGGAATAATTTATATAAATAATAAATACAAGAATTCATAGGTCCATTCCTACAATCCAAAGTGCCTCATAGGAAAATTCCTATAGGTTTACCAATGAGAT
TCCTTTGTTCCAAAAAAGAAGAGCTTAACCTCATGAAAACGGTAGATAGTCTATTACATCTATTTACAAATGTGTTTTCTCAATTTTGACAACTTTCTCA
AACGTAGTAATTCACAACCCCAACATAAATATTCTCTGGCTCCACAGGTGGTCGCTCGATCACTGTTATATTTTCTGTCTCTACAAACTCCCACTTTCCT
AGCAGTTGATGCCACAGGTTTGGATATTTGGGCCAGCGAGACGGGTAGTGAATGGATCAACACGAACCCACAGCAAGGAGAAGATAGAAGCGAGGAGGAC
AGCCCAGACGATGACAATCGTCGGTGTGCGGTTTTGCCTGCCCATAAGACCCTTGAGGAATGGGTATAAGTGAACAATCACCCAGAAGGCAAAGAAGAGC
TTCCCAAAGAGCGGCCCCCATGATTGGTAACCACTGTTGATGGCGTAGGAGGTACCAGCAACGACACCGACCATGTTAATGATCAAAATGGTCGTCGGAG
GGATAAGAAGCGTCGTCCACTTGAACATGTAGAGCTCAGCAAAGTCGCCTTCTTCATCATTAGCCTTTGAGGTGACAGTGAAGTTGGTGTCGATACCTGC
AAGCACCTTCAGAAGACCCTGAAAGACGGCAAACAGATGGGCAGAGATACCTCCAATGACCCAGAACTGTTCATTCCTCCACCACTCGTCAATGCCAACA
CCACTCCACCTCATCTCAAGGATACCAGTGGCGAAAATTGAAAGGAAGAGCGCAATGAACCAGATACTGGCCAAGTTGCTAATCTCTGGCATGATGAACT
TTCCAGTGAGCAGACAGATAGCAGGCAATATACAATAGACTAGAAGCGGGAGAGAGGTTAGTGGGTAAATGGTGGTGTTGATGTAAGCGAATCTCTCCAG
GAACTTGAGGCGCCCTCCGTAGCCATACCATAAGGGGCAATGCCGGCTGAAAAGAATTTCAACAGAACCAAGAGCCCACCGCAGCACTTGATTCAGACGA
TCTGAAAGATTGATGGGGGCAGATCCCTTGAAAGCTGGGCGCTTGGGCATGCAATAGACTGAACGCCAGCCTCTTGCGTGCATCTTGAATCCAGTTAGAA
TATCTTCTGTGACAGATCCATAGATCCAACCAATCTCAGTTCCCCATTCAGACTTGTCCTCATAGCCACAACTTATGACATGGATAGCTTCTTTCAAAAG
AGATTCTGGAGTGGACGACTGAGGAACACCACCATATTCCATCAGAGTGGAGGCAACAAATGCTGCTGACTGGCCAAATCTCTTCTCTAAGCTCATTTGA
GACATGAGAACTGATTTCTCATCATCAAACCC
page-top