Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22385  (registered. 2003)
Contig Information
Length 580 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit 40S ribosomal protein S25-1 [Zea mays] >gi|195658723|gb|ACG48829.1| 40S ribosomal protein S25-1 [Zea mays]
Score 337
Evalue 4.12504e-30
Total Hit Count 252
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22385
CCGCCGCCTCCTCCTCTTCGCCGCTCCCGCTCCCGCCGCCGCGCCACCGCCGTCAGCCATGGCACCGAAGAAGGAGAAGGCCCCGGCGGCGTCGTCCAAG
CCGGCCAAGTCCGGCGGCGGCAAGCAGAAGAAGAAGAAGTGGAGCAAGGGCAAGCAAAAGGAGAAGGTGAACAACGCGGTGCTGTTCGACCAGGCCACCT
ACGACAAGCTGCTCACCGAGGTGCCCAAGTACAAGCAGATCACGCCCTCCGTCCTCTCCGAGCGCCTCAGGATCAACGGGTCTCTGGCACGCAGGGCTAT
CAAGGACCTGATGGAGAGGGGACTCATCAGGATGGTGTCAATCCACTCCAGCCAGCAGATCTTCACCAGGGCGACAAACACCTGATTTATCATTATCATG
TGTTCTGGGTCTGTTTTTAGTCCAGTAGACTGAGGTGTTGCTGTTACATTCAAGTTCACTATGTCCAGGGGGGCACACTGTGCCACCAGTAATGTTGAAT
TGCTTTTGAGTTTTGGTACACTTTAAGATCGTTTTGTCAGCGCAATGAAATCTACCTCATATATTGCCCTAAAAAAAAAA
page-top