Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22351  (registered. 2003)
Contig Information
Length 1467 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 8
Homology (BLAST) Top Hit apoplastic invertase 1 [Hordeum vulgare subsp. vulgare]
Score 242
Evalue 2.1867e-18
Total Hit Count 238
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22351
GTTTTTTTTTGAGAGGCTCAAGAGAAATCTCATCACATTGGCATCATCAGAGACATTGCATCATCACATACGAAGGGCATAACACCAGTAGATTTAACAT
ATACTAGATACTACTAGTACTCGATAGATTATCAGTCTCACAATGACATTGCTTCATCGGTGCGCAACAATAGCATCAGGGTAGGCGGATCAATCCCACA
TATATATGTCCACAGGATCAACTAGAAATATAGATAGATAAGATAGATACATGGTTGGTACTAGATGGGATAGCAATGGCGAAGCTCCTCGTCAGCTTCT
CAGACCACAAGAGCAAGAGCACCGTCGTGGATGGGATTAGGCCCCCACCAAGAAAGGACAGCGAGCGTTGTTGGCCTGAACATGGCGCTCATACCGCGAC
ATGACCCTGCCGTCGCTGCCGATGTTGTCGTCCTGCGAGTGGTAGCCGTCCGACACATCCCCATCCGAGTAATCCACTTGGTCCGTCTGTGGCTTGGTGG
ACTCGATCCACGCCAGGAACGCTGCCCCCTCCTCATCCCGCTCCAACTCCACCTTCCTCTTGGAGCCACACTTCTCCGCCTCCTTCTCCGCCTCCGCCTT
GGCGTCGAGGAAGTCCTCCTCCTTCTCCAGCAGCGCCACGAACTTGATGAGCGCCTCCTCCTCCTCCTTGGTGAGGGTCCTCAACTCCACCTTGGCCTTG
ACCTCCTTTGACTTGGCCTCGACCTCCGGCTTGGCCTCCTTCGCCTTGGCCTCCTTTGCCTTGGCCTCCTTTGCCTTGGCCTCGACCTCCGGCTTGGCCT
CCTTCGCCTTGGCCTTCTTCACCTTGGCCTTGACCTCCGGCTTGGCCTTCTCCTCCTTGGCCTTGGCCTCCTTGACCTCCGGCTTGGCCTTGGCCTTCTT
CGCCTCCGCCCTCAACTTGACGGTGAAGGCCTCCAGCTCCGCCTGGAACGTGGTGAAGGGGAAACCCTCCAAGCCGGCGGGCAACGGCATGGACAAGTGC
ATCTTCTCGACGGCCATCGCCGGATCCGCTCCTCTCCTCTCCTCTCCTGGTCGTTTCAATCAGGGTTAGGGTTTGGGTTAGGGTTTGGTGGGGATTGGGG
ATTTCTCGGCAGGACCTGCATCCTCTCCCGGGTTTATCCAACGCTCGCCCTAGGCAAGAACGCTCACCTTCATGTTTTCAACAACGGCAAGGCGGACATC
AAGGTGTCACAGCTCACGGCGTGGGAGATGAAGAAGCCAGCGCTCATGAACGGTGCTTAGAATTTAGGGTGGATATCTACATGCAGGCTTCCTATACATG
TGCCTGAATTTGGCTCACGTTCTGTTAAATTGGTCTCTGGTGAAACATGATTGGTCTGTGAGGGTATCGTATGTAGCTAGGTTTGCACGTAGTATAAGTG
CACTACGAAGGGATCATTTTGCCCGTAGGAACAATAAAAGTTCTATGCATATTCTGTCGTGCGCATT
page-top