Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22339  (registered. 2003)
Contig Information
Length 1040 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 4
Homology (BLAST) Top Hit Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|41052953|dbj|BAD07863.1| unknown protein [Oryza sativa Japonica Group] >gi|113537353|dbj|BAF09736.1| Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|125540776|gb|EAY87171.1| hypothetical protein OsI_08572 [Oryza sativa Indica Group] >gi|125583348|gb|EAZ24279.1| hypothetical protein OsJ_007762 [Oryza sativa (japonica cultivar-group)] >gi|215767691|dbj|BAG99919.1| unnamed protein product [Oryza sativa Japonica Group]
Score 139
Evalue 1.16889e-06
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22339
TTTTTTTTTTGGTTTAAAATAACAGCAAGCTAGTTCAAGAGAAATATCATGAAAACAAGATTCAGAACAGAGCATCCACATTCCACAGGGTTTTAATCAG
AAGCTACACAAGCATATAACAAGCCCCATATCTAATGCTCATACAGAAGTTCCCCGAGGCTGTTAATCAACATCAGCAGTATGCACTAACAACTAACATG
GGTAGACTCAAGTTCGAGCTGCTACACCTACCACAGATGTCCTAAAGCTACAGCATTTACCAACAACCCTCTCCGTGAGGATTATTTTCCTTCTTGGCCC
AAGCAGAAAAGATACCAGATCAGCAAGAACAAATTGACTATCGCTTTGATGGAGGCTTCTCATCATCATCACCATCATCATCACCGTCATCATCATCTTC
ATCCTCCGCGCCAGACCTCTTCCTCTTCGAAGAGGATTGCGCCTTGACAGAATCCTCACCATCCTCAGCATCATCATCCTCAATCTCCTCGTCCTCAGCA
CCATCACCATTTTCTTCTGGCTCAAAGTCACTGGAATGCTCTTCGTCTTCAGCACGGCCAAGCGGCTGCACCAGATATTCAGTTCCTAGCTCCTCCTCAG
GCTCCTCCTCCTCGTCGACTTCGTCGTCGTCCTCCTCGTCATCATCGTCGTCGTCGTCGTCGTCGTCATCGTCACCACCCTCCTCTTCGTCGCCGCCGCC
GTCGTCCTCGTCGGAGATGTCGACCACCTGCTGCGGCGCCGACCCCTTCTCCTCACCCTCCACCCCCTCGTCATCGTCATCTTCCCCTCGTGCCGAATTC
GGCACGAGGCCATACTGCCCTCCGTGAGCGCCCCTGAGCATAACATCCTGGCGCTGCTTGACGAGTGCGACGTGCCTGAGAGCCAGCGCCCTGCTGAATG
AGCCTGGATGCCGTCTCCACTGTATCTGTACATTGCTGTATCTTCCATCACCGCCGTCGCTACGAGCTGTGGATACAGCCGTGTTGAATCTCCGGTTGCA
ACTAGCAACAGCCTTTTGTGTGGATTGTTTCTATATATAT
page-top