Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22287  (registered. 2003)
Contig Information
Length 796 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 541
Evalue 1.81898e-53
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22287
GCAACCTAGCAGCAATGGCGTCGTCGTTGCTGAAGCCACACTCCCACTGCTCCGCTCTGCCGTCCGGGAGAAGCAGCGGCCTAAATGGCGGCAGCTGCCC
CGCGACGGTGCACCTAGTGCAGAGGCCAGCCGGGAGGAGGGGCGACGCGCTGAAGGCGAGGGCGTTCCCGCTGGACGTGGTGCCGCTGATGGTGACGATG
GTGGAGCACGTCGACAACCAGAGGGACTGGGTGGTCACCAAGTCCATATGGCATCTCAGCGACACGGCCATCAAGAGCTTCTACACGTTCTACGCCATGT
TCACGGTCTGGGGCGTCTGCTTCTTCGCGTCCATGAAGGATCCATTCTACGACAGCGAGTATTACAGGGGGCAAGGGGGTGATGGCACCGTGCACTGGTA
CTACGACCGGCAAGAGGACATCGAGGCGACGGCGAGGGGGGATCTGCTGAGGGAGGAGCTGCTTGAGGAGATCGAGCAGAGGGTCGGAGGGCTGAGGGAG
CTCGAGGACGCGGGAATGGAGGGGGAGCTTGAGGAAGCCAAGTAACCGTGAGACCCAAGCGTATATATGCATGGATTGGCAAAACAGCTTGCCTTCCTCC
GCTGAAGTTGAGTGAAAAGCTTGGACTCTTCAGTCTTCAGTGTAGTACCGTAGAAACTACACAAGTACACATAGCAAGATCTTGTGGCAAATTGTGCAAT
ATACATTTGTAGTACAAAGCAAGATATACATTCTCCACTAGAATTGGAGGCACGCCATTACCTTGCTATGCCAATCGAAATCACAGATTGATCAAA
page-top