Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22267  (registered. 2003)
Contig Information
Length 872 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_11301 [Oryza sativa Indica Group]
Score 685
Evalue 4.27083e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22267
TTTTTTTTTTATTCTCGCATAACAAAAGGCAAAAATTATTCCATTTCATTTTCCATGGTAGTGTTTGCGTGCGCTGCAACTTTTTCTCCCCAAACGAAAC
ATCGAAACTCTTGCCTAGACGATACATCGAAACAAAATCTTGCTGCATGTCGTACATGTCGCCATTTTACTGCACTGGAGTGGCATCAAGCCGGCCAGCC
TACCTGTAGATCACTGGGTGAACACCACATTCGTGATGTCGGGGAACTTCTCCTTGATGGCTGCCTTCACTCCACTTCCGATGGACTCTGGGCCGTCATA
CTTAACCAGGCAGTCCTCGCCGTCAACGGCAAGAACCTTCACACTCCCGCCGTAGTTCGCGATCGCCGGCCGCAGTATGTCCAGGTGCCGGTTCACCGCC
TCAGGCGTTGTCTCCTCCGGCTGCTGGTCCCCGTCGAACACCTGGCGGATGTCCTTGATGGCGTCACCGAACTTCTCCTTGAGCACTCGCTCGATGCCCA
TGTTCATCGTCGTCGTCGAGCTTGGACAACTGCTGCACGCCCCTTCAAGCCTAAGGGAGACGACGCCGTCCTCGACGGACACGACGGCGACGTCGCCGCC
GTCGGAGATGAGGTAGGGGCGCACGTCGTCGAGGACGCGGTCGACGTTACCTGGCGTCAGTTCGTAGGTCACCGCCGAGTACAGGCCGCCTCCCGGCGGC
GGCGGCGTGGATGCCGAGGCCGCAGCCAGGTGTCCCCGGAAGTTGGCGGTCCAGATCTTGGAGTCTCGGAATTGGGGTCGCCTAGGGAGCACGGGCGGGT
TGAATTTGATGATTCGGCGACGGATTTGCGGCGGAAACGACGAGGTAGCGGCGGCGGCCGCGGTCAGCGACG
page-top