Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7568  (registered. 2012)
Contig Information
Length 781 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VHS Shoot with heat shock treatment 4
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|118152402|gb|ABK63945.1|| ribosomal protein L3-B2 [Triticum aestivum]
Score 386
Evalue 2.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7568
AGGCAAGCAAACTCATTTCAGAAAATTTGCGACAAGGTACGACTCTAAATAGGTTTCAACAGCTAAATCACAATAACAATAGCACATGACACGAAGAATT
CATAGATGAGCCAGATTCTGAAAACATCAACTAGTACAAAACTTAGGCAGGGGAAGTAATCAAGTATCACATGTTCGTTTTGACAAAATGATATAACTGA
TGATGCGCGGCGGCAGCTCAAGCCTTGAGCTTGCCGTAGAACCTCTGCTTCTCGTCTGTGGTCTGGAAGCGACCGTGGCCGAACTTGGAAGAGGTGTCGA
CAAACTTGAGCTTGATCTCCTCCAGGGCCAGACGAGAGGTCTGCTTCAGCAGGGACTGGCGGAGGGTCACCACGCGCTTCTTGGGGCCGACACAGCATCC
TTTGATCATCAGGTAGTCAGCCTTCACCACACCATAGTGAGGGAAGCCGCCCATCGGAGTGATGTCCTTCTCGGTCCTGTCGAACTCAGTAGAGGCATCA
TGAGTTTCCTGTCCAACCTTGCCAATCTTGTAGACCTTCTTGTTCATCTCAGTTCGGTGGTGGTATCCATTCTGACCAGCACGAGCAACAGTGTAGGACA
CCCTAGCAGGATGCCAGGCACCAATACAGGCAACCTTGCGAAGACCTCTGTGGGTCTTGCGGGGAAGACGGGTGACACCCCAACGTGTCACAACACCTTC
ATAACCCTTACCCTTGGTAACTCCAATGATGTCAATCATCTCATCTTTTTGGAATACAGCATCAATGGGGACTTCCTTCTC
page-top