Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7567  (registered. 2012)
Contig Information
Length 836 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125561623|gb|EAZ07071.1|| hypothetical protein OsI_29317 [Oryza sativa Indica Group]
Score 294
Evalue 7.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7567
TATATATTCCCTTCTATGATGTGATCAATTGCCTTCTACAACGGTTATGATTTTCTGAAGAATTGTGCAATATAAGCAGCGCTGGTACAATGCTGTGGCA
TTTGCCAACAAAGCTATAGCAAAACTCAAATCCGCCACGAAAACACCAGTCACCACAAGTTTCAGTGCTAAGATAGGAACTTTGTCGCAAGTACTGACGG
TGATGAACTCTGACAAGGATCAAAAGCCCAAATCATGGGTGCGGATAGCCAGGGGGGTCCCATGGCCCAGCACCGTAGCGTTTCTCTCTGTAAGAATAGC
CGCTGTCGTAGATGTCTTGCAAGCCCATCCCAGGAGTTGTCATAGGTGGTCCGTAAGCTCCATGGCCGCTGAAACCAGGAGGCCTTCTCTTCTCAATCTC
AGCCCTAAGCTTCTCAGACTCCTGAGCCATAGTTACAAGGTCCTTTTCCACTGCCTGCACCTGTGCCATCAGCTCTGCCTTTGCATTCTTTTCATAATCA
AGAGCGGCCCTGGTACGAATTAGTTCCTGTCGCAGACCATCTCGTTTAGCTACCATGGCAGGTATGCGCTGCTTTTCAGAGTTCTGATGCTCAACCTCCT
TTGTTAGACCCTGCACCTTTTCAGTCAACTCTTGCCTCAAAGACTGCAGCGTGCCTGCTTCAGATCGTAGCTGCAAGGCATGTTGCCTATGGGGTTCTAA
AGAGCGTAGCTCAGCTTCCAGCTTCAGGTTCCTCTGAGTCAGCTCCCTCGATTCAAGTTCTTTCTCTGCGCGGAGCTTNNNTATAGCCTGACTTGAGGAA
TAGAGATCTTCTTTCAAATGAGACATTGCTTGCCTG
page-top