Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7566  (registered. 2012)
Contig Information
Length 1391 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242060200|ref|XP_002451389.1|| hypothetical protein SORBIDRAFT_04g001270 [Sorghum bicolor]
Score 574
Evalue 8.00E-162
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7566
ATTACACTTGTACTCAGCACATAATCACCAAAAATGCTGAGGAGAATTTCCCCTCAGAACTATATCAGATGGCGCAGTTGCAGCACAGGCAATGCCCACA
CTGCATGACTATGACATTGGTGTGTGCGCTTCTTTCTGTAATTTCAGTTGCATCATCAGCTCAGGATGCATGAACACTCTGTTTTCAAGGGACTATATGA
ACATGCTTTGGCGGTTTGGCCTATGTGTCTCCATTTGCCAGTCAGACTGGCGTCTCAAGTTCGCCACGCGGGCGATTTCTCCTGATCGAAATTCTCTTCC
CACCAAGTGGCATTCTTGTATCCTCTTCTGAGGAATTCAAGCTGGCTGCCTACCTCTTCTTGCAAACCGAGAACTCTCAATAGTTCATCCTTGGCCTGCC
CCAAAGTGAACCGAGATGCACTCTCTGCAACACATGCATAGGAACCATCACCCTGCTTAAGCATGACTTGCCAGGGCCCTGGGTACTGACGGAAGACAGC
GCCACTGTAGTTCACTATGTATGGAGTGACCGCAATTGTCTTCGAGTAGTCACGCTGTCTGATATAAAATACTGGGGTAAACTGAGAAAGAAACCGGTAA
TGCAAATCTTTTGGGGGGAATCCCAGAAGCCCCAGGTCAGAACGCAAGGTATCTAGTTCAAGGTTAAAGAGAACAGCAGGTACACAGGCAGCAAATTGGT
CCACATACTTCTCTATAGATGAAAGGTCACCCGTGCTGCTGTTGATAAAGATATATAGTGATGGTGGTTCGTCAGACTTCCATTGATCTTCGTTGTCATC
AGCAAAATCGAAATCAAGGGTACTTCTTATCGATTTGAAGAAGGTATCGACAGGCCCGGTGGGCAGATCGTCCAACGAGCTGATGGATATACCCTCGATC
TGATCTATAGCTGTTTTGAATATCTGCGAGGCCCTTCGCTTCTCCGGTTGATCAGGAAACACTATGCAGGACCGAGTCCCCTTGAGCTTTTTGAGGTCCC
TAACGACGGCGAGAGCGAGCTGGACGTTGGCATCAATGAACTCGTCCGAAGACCCCTTGTAGGAGGAGATGCTGCTGGGCAGAGGCGGGAACTCGATCTC
GAGGCGGGTCCTGCCGTCGTCGATGGCGGCGGCGAGGGAGCGAGCGGCGTCGGAGACGAGCACCTCGTAGGAGCGCGGCTTGTAGACGGACACCCCGGCC
CTCAGCTCCCCCACCTCCGCCTCCTTGGCCGCCTCCGCGCGCACCGACCGGAGCCTGCGGCGGCCGCCTCGGACGCGCGCTGGCGCCCCTGCGAGGCGGG
CGGGCGGAGCCGCGGGGGAGCGCAGGAGGCGGACGGCGGTGGAGAGAGGCGCCATGGCCGCGCGCGGGGGAGGAGGGGGAAGGAGGAGAGG
page-top