Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22225  (registered. 2003)
Contig Information
Length 1525 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os09g0516600 [Oryza sativa (japonica cultivar-group)] >gi|16209608|gb|AAL14249.1| glyoxalase II [Oryza sativa] >gi|50726249|dbj|BAD33825.1| glyoxalase II [Oryza sativa Japonica Group] >gi|113631906|dbj|BAF25587.1| Os09g0516600 [Oryza sativa (japonica cultivar-group)] >gi|215697948|dbj|BAG92136.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737215|dbj|BAG96144.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202459|gb|EEC84886.1| hypothetical protein OsI_32046 [Oryza sativa Indica Group]
Score 1513
Evalue 9.51863e-166
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22225
CAATCGGCACATTGTCCAATGTTCTCCAGCGTAAAATCTATCACCAGATGACGAAAACAATGATAACCGGCAAGACAATGAGGAAACAAGAACTGAAGAA
CACTATCAAACAGCTAACTAGCTTTTTCTCTCCCAGGATATAGGATTACACTGACACATTTTATTTGTAGTCGACAAAAGAATCACCAGCTGCTATCAGA
TTAACAAGCACTCTGCGCAAGCTACATACAATGCTAGACAAATTTTCACCAAAGCATTTTTGGAACATCGAGCTATACACATTTCCTTCCCTGCGTTCCT
TCTGTTGTGGTCTTGCCGGGTTCTTTGTCCACTTCTCCTTTTCGAAGAGATGGTTGGGTCATCATTTTATGATAATTTCTTTTGTGGTTAGTCAAAAATT
ATCCTTCGCCCGTCGGATAACTTCAAGAACACGTGCATCATCGAAATGATCTGGAATGGACAGCCTTTTCTTTATCTCTGGACTTGAGGTCCTCAAGAAA
GGATTGCACTGCTTCTCTCTCGCAATTGTTGTTGGCACCGTTGGTGTATTCTTATTGCGCAGATCAGCTGTACTTGCAGCGTATTCCTGAAGTTCTTCAT
TTCCTGGTTCTATGCTCAAGGCAAACCTTGAATTGCTCAGAGTATACTCATGTCCACAGTACACCTTCGTCACATCTGGAAGAGCTACAATTTTTTGGAG
TGAAGAGTGCATATGTATACAAAGATATCTGACCTGTTCTGGAGTCCCCTCAAAAAGCTTTCCACATGATAGACTAAACAAGGTATCACCTGTAAATATT
GCTCCAGATCCAGGGAAATAAAAGCTCACATGACCTGATGTATGACCAGGAGTTTCCATCACAAGAACTTGATGACCCGCAAACATCCATGTGTCACCCT
CGCTTAGAGTTATGTCAATGCCAGGAATTCGATCTTTATCCTTCTCAGAACCAATTACCTTTGCACCATATTTTGCCTTCAGTTCCAAGTTGCCACCAGT
ATGATCATAGTGATGATGGGTGTTCAATATGTAGGTCAAGTTCTGGTTTCTCTTTTCCAATGCGTTTATGATAGGCACCGCCTCAGAAGGGTCTACAACT
CCAACTGTTCCAGTATCCACATCATGCAAGATGTATGCATAGTTATCTTGAAGACAGGGAACGAGCTCGATTTGCAGCGACGAGGAGACGCTGGTCATGT
TGCAGAGGTACCGCGCGGCGCCGAACATCCGGCCCACCCCGTGGATGGTCCTCAGGGGCATGACCAGCAGCGTGCCGATCCCGTACATGAGCGGCTTCCC
GAGCCATTTCCTGCTCACCCTCGGTATCAACGACGGCTGCCCCCTAATCGCGGGGGCGGAGGAGGAGCAGCGCGGGAGGGAGGAGACGACGAGCGAGCAG
GCCTTGGAGAACATCCGCATTCCTGCCCCTCCTGCCTCCGCCGCCGCTCTCGTCGCGTCGCGTCGCCGCCCGCCGACGAGGTAGGGGGGTGGGGGGAACG
GAGAAGGCAATGGGACGGGGACGAG
page-top