Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22200  (registered. 2003)
Contig Information
Length 1599 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_08115 [Oryza sativa Indica Group]
Score 1298
Evalue 8.64346e-141
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22200
CGGCACTCGGCACTCGCATAGTCATCGCATCTTGGCTGCTCACCCCCCCGGCACCTGCAGAATCCCCATCCGCGTTCCACTTCCACCGAGGCGGAGGATG
GCCTCCGACGACAGCAGCTCGAGCCACCCCACGGAGAAGAAGGAGGAGGCCTCCGCCGCCGCCGCCGCCGGTGGAGCTGGCTTCGACGATCTGGAGGACC
CGCGGTTCCAGTGCTGCGTATGCCTGGAGCTTCTGTATAAACCAGTTGTTATTGCATGTGGTCATATGTCATGTTTCTGGTGCGTCCATAAGGCTATGCA
TTACGCCCGGGAATCCCATTGTGCAATATGCAGGCAACCGTATACTCATTTCCCAAGTATCTGCCAACTCCTCCATCACTTGCTTTTAAAGCTTGAACCC
GTGGAATACAAAAAGAGGGAAATGGAAGTACTAGAGCAAGAGAGGAGTGTGGATACCTTTTCTCCACAAATCATCGAGTTCTTAAACTCCAAGAACAATA
ATGGTGAAAATGGAGAAGATTGGGGCAACAAGCTTGAAGATGGCAAAACTGGACCTCCAGGAGAAGTCTCAGTTGATGACAATACTATGAACGAACATTC
AATGAAAATAAAGTTAGATGATGTGTCTTGTCCTATCTGCAAGGAGCTGCTGTATCAACCTGCTGTTCTTAACTGTGGTCATGTGTATTGCATATCTTGT
TTGCCTTCCGTGGGTGATGAAGCATTGAAATGTCAAGTCTGTGGAGGTCTTCATCCTGGAGATTTTCCTAATGTTTGTTTAGATCTTGACCACTTTCTGG
AAGAATATTTTCCAGCAGAATATGAATCAAGACGCAAGAAACTTCAGCTTGAGAATAGCCAATGCAATCCTGAAGGATCATCTTCAAGTACTTCATGCAA
GAAGGGAACTTTTGTACAGAAGACTCTAGACTTATCAAATGTTCACATTGGAGTTGGATGTGACTCATGCGGGGTCTATCCGATACGAGGCAAGCGATAC
AAATGCAAGGATTGCACAGAGGCAATTGGATTCGACCTTTGCGGGGAATGCTACGACAGCACTTCAAAGCTCCCAGGCCGCTTTAATCAGCAGCACACAC
CTGACCACAGGATGGAACTCGACAATTCATCACTGTTTGACGCGTTCCTGAGATTCCAAGGGATACCCGCGGAGGGTCTGCAGCAGCTGGTACAACAAAT
GGAGCTCATTGGTGCTGGTGGCATGGTGCAGTTAGTGGCTGATGATGAAGAGATGGAGGACAATCATGAGGATGCTTAGTTGCTGTAGGAACCAAGCAAG
CATTTCTAGCAAAAGCTGATTTGGGGAGCGAGCCTTGAAATATTGTGGTGATCGGATTAAATGAATGTAGCGTGCTCCATTGTCCTTGATTCCTTTTGGG
TCCGAAGGTCAATTAGTCTTGTTTATGCTTTCGTACATTTATTTATTACTGTATTATATTAGTCTTCCATCTATATAATAATAAAAAGAAATTATATATC
GGTCTTCCAGTCAAAGCAAATTGCGGTGGCACTTCCAACAATTTCTTATGTAAACCCGAGTGATTTTTACACATATTCCTCTGGTATAGCAATATTCAT
page-top