Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22196  (registered. 2003)
Contig Information
Length 702 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit 40S ribosomal protein S21 [Zea mays]
Score 386
Evalue 1.32792e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22196
TCGGCGCCCTTGAAACCATAGTCCAAGCTCGGGTTGCGCCCACCGGACAGGTTGCCTCGTGCNGAATTCGGCACGAGGCACAGCTCCGCCGCCGCAGCCG
CCGCACCCGTCCATCTCCCCCCTTAACCGAGCAGTGTCCCAGTATCCCTCCAGTCCCCATTATGCAGAACGAGGTGGGTGATATGGTGGACCTCTATGTC
CCAAGGAAGTGCTCTGCCACCAACAGGATCATAACTGCCAAGGACCATGCCTCTGTCCAGATCAACATCGGGCATGTGGATGCGAATGGACTGTATAATG
GCAGTTTCACCACGTTTGCCCTCTCTGGATTCGTCCGCGCCCAGGGTGATGCCGATGGTTCTTTGGACAGGCTCTGGCAGCAGAAGAGGGCTGAGATCAA
GCAGTAGATGAGTTCCGCGTGGCAGATTTTGCTAGGATGGATATTTATGAAACCGCTTTAAACCTTTTTTGAGGAATCTGTTATGGGTGTTTATGCTTTG
CCTATGAATGGTCTATGATAAAACCGTGGACTGCACGCAGTGCTTATGGAAACCTTACTTGAAGAATCATTATATCTTTGTCCATGAATGGTCTATGTTT
CTAAGAGGAAACACTAGACTTGGTGTAATATGCTTCCTGGCAATGTGCCTGAATTCTTAAATGCATTTTAGTCGCTGCTCTTATGGCTCTCTAAAAAAAA
AA
page-top