Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22194  (registered. 2003)
Contig Information
Length 688 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 4
Homology (BLAST) Top Hit Os02g0190900 [Oryza sativa (japonica cultivar-group)] >gi|46390968|dbj|BAD16481.1| phytoene dehydrogenase-like protein [Oryza sativa Japonica Group] >gi|50726398|dbj|BAD34009.1| phytoene dehydrogenase-like protein [Oryza sativa Japonica Group] >gi|113535685|dbj|BAF08068.1| Os02g0190900 [Oryza sativa (japonica cultivar-group)] >gi|125538425|gb|EAY84820.1| hypothetical protein OsI_06187 [Oryza sativa Indica Group] >gi|125581115|gb|EAZ22046.1| hypothetical protein OsJ_005529 [Oryza sativa (japonica cultivar-group)] >gi|215766902|dbj|BAG99130.1| unnamed protein product [Oryza sativa Japonica Group]
Score 511
Evalue 4.10442e-50
Total Hit Count 311
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22194
TTTTTTTTTTGGGGACAATCTTACAGCGCTGTGCATTATAGCAAAGATAGTACTGTATCAACAAGTACCTGGAAGTAACACCACGACTTGGCCATTCAGT
GACACTACAAGTACAACAATGGTGGAAACATTAGGACTAGAGTGTTAAGTTTCCCATCCAAACGTGTTTGGCTACTAGAGATATGCTCAATTATTGTAGA
GAATACAGAAGATGATAGGGGTGATATACAACATGCTTGGGAGACGAATCATTGTGTGGGAGCAATGTGATATGCGGACTTCACTTTCTTCTCCAAGAGG
GAGACATGCTTATCAAGCATGGACACCACTGCCTCAAACTCACTCACCTGCTGGTCTATCGCGTCGATCTGTGTTGTGTACTCGTCAAACCGTTGGTTTT
TCTCGTTCAGCTGTTCTACAAAGACCCGCAGACCGGATGCAACATCTCCGTGGTTACTGTACTCCTCTGTCACGCGTTGGTTCATCTTTTCAAGCAGCGA
GAGCTGGTTGTTGGTTCCCTGGAGCTCGCCGCGGACCATGAGGGAGACGTTGGTGAAGAGCTCGGACAGCGAGTCGGCGAGCTCGTCTCTCTGCCCTGCC
GCCGCCTCCTCCTTCGCTGGAGTCGCCATCGCCGGCGCTTCCTCCCGCTCCCGCCGTACACCTGTCTCGGAGTAGGAATCGGGCTTGG
page-top