Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22181  (registered. 2003)
Contig Information
Length 1318 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 4
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit Os12g0604800 [Oryza sativa (japonica cultivar-group)] >gi|108862932|gb|ABA99824.2| tetratricopeptide repeat protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649727|dbj|BAF30239.1| Os12g0604800 [Oryza sativa (japonica cultivar-group)] >gi|215706934|dbj|BAG93394.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218187204|gb|EEC69631.1| hypothetical protein OsI_39024 [Oryza sativa Indica Group]
Score 1406
Evalue 2.00856e-153
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22181
AAAAACTGAAAGAAGACGAGGAGCTCGCGACCCCAAAACCCTAACCCCTGTAACTCTCGGCGGCGGCGGCGGCGGCGATGGCGGACGGAGGCGGTGGACG
GGCGGCGGAGCTCAAGGACCAGGGGCAACGAGCAGTTCAAGTCGGGGAACTACCTCAAGGCCGCCGCGCTCTACACGCAGGCCATCAAGCTCGACTCCGA
CAACCCCACCCTCTACAGCAACCGAGCTGCTGCATTTCTGCAGCTGGTTAAGCTTAATAAGGCACTTGCTGATGCTGAGACGACAATAAAACTGAAACCA
GAATGGGAGAAGGGTTATTTCAGGAAAGGATGTGTTTTGGAGGCCATGGAGCAGTATGAGGAGGCAATATCTGCTTTTCAAATAGCTTTGCAGCACAATC
CACAAAATACAGAAGTCGCGAGAAAGATCAAGAGGCTTACTCAGTTAGCAAGGGAACAGAAGCGAGCTGTTGATGTGGAGAACCTGCGTTCCAATATTGA
CATCGGGAAGAACTTGCAGTCATTGAAAAAGGAGCTGGTTACAAAGTATGGAGATGGAGAAATGGGACAAAATATATTCTCATTTGTTATCAGTGTGATT
GAATCAGCGATAAAGGTTTGGCATGACACAGGAAAGGTGGATGCTAAGGTCAATTTTCTTCTTGATGATCAGAAGACTGACACTGAAAAATATGCCCCAG
TGGTTAACATTGAGAAGGCCTTTGAGTCACCCCATACCCATGGCAGTTGCTTCGCATATTTGCGGCAATACTCTGAGGAGTCTTTTTCAAAGGCTGCCTG
TATGGTAGCACCTAAGAGCATCATCTCCTATCCACAGGTCTGGAAAGGGCAAGGATCAAGAAAATGGAAGCTTGACCAGAGTGATGGGTTCTTTGTACAA
TTTGAATCACCAATTTTACGGAAGATATGGTTTGTTGCTAGCACAACAGAGAAGGGACGAGCATTGTGCAGGAGCCCTGAGCCCTTGGACATTACCATCC
ACGAGATCCTTCCTCGTATATTCAAAGAGAACGAAACCAGTGCTTGAACGACAGGTGCACCGTCGACGAGATCTTGATTCCACCACCCCTGACTGCGTGA
TCTGTATTGCTCGCGGTGGTTTACGGTTGAGAAGGGGGCAGGTATTTTCTCACACAGGAAGAACTGAATGCCATATGTCTTGTAAACCGACGATCCAGTG
TCGGTGTCATGTACACCCAGGCACTCCAATTTTGTTGCTGTGTGGTTTTTGCTGTATGCAGTGTATACAAGCTTTGGTGGGGTTATGCTAGTTGCGTTTC
TTTCGTTCAAAAAAAAAA
page-top