Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7560  (registered. 2012)
Contig Information
Length 1008 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_VWD Shoot grown with dessication 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|193848548|gb|ACF22735.1|| beta-glycosidase [Brachypodium distachyon]
Score 467
Evalue 1.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7560
TTTTTTTTTTCAGTCAAATCAAGAATTTAACTTGTTTAGACGTTCTGAGGATAAGAACAAACTAAAGCAAAAGGAAATTACAAGGTACTTCTACTACTAC
AGTGAACAGTATAAGCATGTACATTTAAAATGCAAAATGTGAAGCTTCCACTTGCCAGAACTTCTTATGTGCTTCCTCCAGAGGAAATATTACCCAAAAG
TTTGATGTTTTTTTATTGTAACCAAAGAAACAGAACTTGAATAGCAACTACAATAGAAGGTCTCAAGAAGAAATAGAGTAAGAAATTGCATCGTCCTCAA
TGTAGTGAATCTTCTTGCGTGGAAATGGTCGCATAACGCATCTTACAAAGCGACTCAAAGGATCCTGCAAGCCTTCTATTTCATAGTGGCCAAATCGCCA
GTCCCGCAATACAAAAGCTCGCTCAATAGGCCGATCTAGACCCCCTGCATACATACGACCATGTTTATCTACTTCCCTGTAAAATGGGCGTGTTTTCTTC
TGAATCGCAGCTTCTTGCAGTTCCCTCCAAGCGGATGTTCTGTCCTGTCTCGTAATTTTTCCAGTTGTGACAACCTTGGTGAACAAATAGTACGAAGGGC
GAGGTTTCCGTGCTAGGTTATTAGCACGGTCAACAGAAACAAGCCCAAACTTGGGACCATAGCCATCAGCCCACTCCCAATTATCCGACGTTGTCCAGAA
TAGATAGCCAAGCACACGCACACCCATTAAAATGGCCGCGTATATGGCTAACAGGTGCTCCAGTATATATGGTTTCCGAATCAGATCAGTCTCATCAGAA
ACTCCATTTTCAGTAATGATAAAAGGTATGTTTAAGCTCTTGTATCGCTCATTGAACTTAAGTAGGATGCGAAACAGCCCATCGGGATAAACTCCACGAC
CAGATTCACTGTACTCATCATTTTCCACGTGCTTTAGACCAGGTCCTGATATTACCTCCTGACCATAGTAATTGATGCCAATAAAGTCCAACTTATCACA
GATGCTAT
page-top