Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22163  (registered. 2003)
Contig Information
Length 1278 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHDr Shoot grown with dessication 3
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Os06g0112200 [Oryza sativa (japonica cultivar-group)] >gi|7363290|dbj|BAA93034.1| methylthioadenosine/S-adenosyl homocysteine nucleosidase [Oryza sativa Japonica Group] >gi|32352128|dbj|BAC78557.1| hypothetical protein [Oryza sativa Japonica Group] >gi|113594632|dbj|BAF18506.1| Os06g0112200 [Oryza sativa (japonica cultivar-group)] >gi|125595804|gb|EAZ35584.1| hypothetical protein OsJ_019067 [Oryza sativa (japonica cultivar-group)] >gi|215694661|dbj|BAG89852.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740802|dbj|BAG96958.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1098
Evalue 9.92752e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22163
TTTTTTTTTTGAGTCAAACAAACAGTACTGTAGAATTATTGCAGTTAAATGGTACAGCATACATATGGCACAGCTGCTCCCAAAAATAAGTGCCTTTACT
ACTCACTGCATTTGGAAAGTATTCATTGCTCACTGCACTTGCGAAGCACCATGTGATGGAGCTGGCAAGATCCATCAACCATTGTGCTGAATCCATGGGA
GTTCCAGTGCCCATCATTTATTCCAGTGTAACCATACACCACCTTATTAAGCCGAGCTTCACTAAGCTGCACAGTTTGTAAAATTCTACAAAATCCCATA
CAATGGCTCCGAGTAATCGCCAAGAAATTTTTACATAGGGGTTACGATAATGTAAAATCGTGTGTGAAACCCCCCAGGAAACATTATACATCCAACAATA
TATATTCAGGCTCCCTCAGTTTGTGGACCCCAGAACAGCATGGCGGAGTGTTCGGCGTTCAGAGATCAGAGATACATTTGCCGCTGATGAAGTCTACCAC
TTGCAAGACTGCCTGGTCCAGCGCCATCGTCACCGAGATCAGGTTTTGCAGAAACTCCTCGGCTGTTGGCTTCTCCCCATCAACAATGTCAGTCACAGCC
TTGACAAAGATAGCGGGTGTCGAGAACAAGTCAGCAACATACGCCACCGCTGCTCCCTCCATATCCTTGACTGTAGCTTCATTGCTCAGTATTGCTGTCT
CATCATGGGGGGACATATCCAGAGAATCACCAGTTGACAGTTTCCCAACCTTCAAATTGAGTTCCTTCACTATATTTGGGGTTTCAAATGTTTTTCGTGC
TCCAATTCCATAACTGTCAAAAACAGGAATGGGTATTCTCCTGTCATGGAAAGCAACATCTGAAGCTAAGAAGACATCCCCAATACCTGCTCCTCTGGCC
TTAAAACCACCAGCAGTACCAGCGTTGATGATAAGGTCTGGCTTCAACAATTGTATAGAAGCATAAGTCACAAGAGCTGCGGATACTGTACCAACACTGT
CAACCCCAAGCACAGGATCTTTTCCAGGCCAGACGAGATCGATGTGGAGGCCTTTGTAGTCGCCATGGTACCGAGTCCAAGGGGCACCTTTAGGAAATAT
GGATTCGTCGGCGGCCGCCTCGACGAGCTGGAACCGGGTGACGAGCGGGAGCGCCTCCGTCTGCATCGCTATGACGACGAGGACCTTGGAGATAGCGCCG
GCCCCAGCGGACTGGGCGGCGGCAGGCTCTTCAGAGGACGGCGGAGCCATGGCCGGAGGCGCGGGGCGGCGCGGGATC
page-top