Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7559  (registered. 2012)
Contig Information
Length 991 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242051046|ref|XP_002463267.1|| hypothetical protein SORBIDRAFT_02g040850 [Sorghum bicolor]
Score 637
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7559
CACAGCAACCTAGTGCAGTTCTATGATGCTTTTGAAGATGAAGACAACGTGTATATAGTTATGGAATTGTGTAAAGGAGGCGAACTACTTGATAAGATAT
TGGCGAGAGGTGGAAAGTATTCTGAAGAGGATGCAAAGGTTGTTATGCTGCAAATTTTGAGTGTAGTATCATTTTGCCATCTTCAAGGTGTTGTTCATCG
GGATCTGAAACCAGAGAATTTTCTATTCTCATCGAAGGAGGAAAACTCACCCTTGAAGGTCATAGACTTTGGCTTGTCTGACTTTGTAAAGCCAGATGAA
AGGCTCAACGACATTGTTGGAAGTGCGTATTATGTTGCTCCCGAGGTGCTTCATCGATCTTATGGCACGGAGGGAGATATGTGGAGCATTGGAGTAATTG
CCTACATTTTGCTTTGTGGGAGCCGACCTTTCTGGGCACGCACAGAATCAGGAATATTCCGAGCTGTCCTTAAGGCAGAACCAAGTTTTGATGAGGCCCC
ATGGCCTACTCTCTCTGCGGAAGCCAAAGACTTTGTAAAAAGGTTGCTTAATAAGGATTACCGCAAGAGGATGACTGCCTCACAAGCTCTGAGTCACCCA
TGGATCCGTGATGCACAACAAGTCAAAATTCCTTTAGATATGATAATCTACAAGCTTATCCGAGCTTATATCAGTTCATCTTCACTGCGGAAGTCTGCTT
TGAGGGCCCTAGCTAAGACATTGACAGAAAATCAACTCTTTTATCTAAAAGAGCAGTTTGAATTGTTGGGTCCAAACAAGAGTGGTTTAATCTCCTTGCA
AAATTTGAAATCGGCTCTGGTGAAGAATTCTACGGATGCAATGAAGGATTCCAGGGTTATTGACTTTGTTAACACGGTATGCACCCTTCAGTACAGAAAA
TTGGATTTTGAAGAGTTCGCCGCTTCCGCCATCAGCGTATACCAGATGGAAGCTCTGGAGACCTGGGAACAGCATGCTCGGCGCGCGTACG
page-top