Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22158  (registered. 2003)
Contig Information
Length 810 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit Os06g0650100 [Oryza sativa (japonica cultivar-group)] >gi|51534981|dbj|BAD38105.1| polyubiquitin 2 [Oryza sativa Japonica Group] >gi|113596261|dbj|BAF20135.1| Os06g0650100 [Oryza sativa (japonica cultivar-group)] >gi|215692861|dbj|BAG88281.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218186299|gb|EEC68726.1| hypothetical protein OsI_37226 [Oryza sativa Indica Group] >gi|218198663|gb|EEC81090.1| hypothetical protein OsI_23921 [Oryza sativa Indica Group]
Score 675
Evalue 5.40199e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22158
GTCGTCGTCGTCCCCAATCAATCAATCATCAGCGAGCGAGCGACCTAAACCTCCGCTCCGTCTCCGCGCAAAACCCTAGCGGATCCATCGACCTCGCGGA
GAGGCGGAGAGCGGAGAGCGGAGAGAGGGAGTGGGTCCGAAGATGCAGATCTTCGTGAAGACGCTGACCGGCAAGACCATCACGCTCGAGGTCGAGAGCA
GCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCAGATCAGCAAAGGCTAATTTTTGCTGGAAAGCAGTTGGAAGATGG
GCGAACATTAGCTGATTACAACATTCAGAAAGAGTCGACGCTCCATTTGGTCCTGAGGCTCAGGGGTGGAACTATGATCAAGGTGAAGACACTTACTGGG
AAGGAAATCGAGATTGATATTGAGCCCACTGACACAATCGATAGAATCAAGGAACGTGTTGAGGAGAAAGAGGGTATTCCACCTGTTCAACAGAGGCTCA
TCTATGCTGGGAAGCAACTCGCTGATGACAAAACTGCTAAGGACTACAACATTGAAGGTGGTTCAGTGCTCCATCTTGTGCTTGCTCTGAGGGGCGGTCA
GTAGATGCAAAGTCGACGTGGGCCGTATAGGCCATTTCTACCAAAACTTGTTGCAGACCTAGATCTGTGAATTTGCCGGTTGATTGAAGTGCCATGTAAT
TGACGCATTTGTGAAGTCAGCTGTCACCTGTACTTGGATGGAATTGTTTGAACTATATGCTTATCTGTTGTCATCTGATTTCTGGTTGCTCTGAATCATA
TCTTCTACAA
page-top