Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22157  (registered. 2003)
Contig Information
Length 851 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 8
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit arachidonic acid-induced DEA1 [Capsicum chinense]
Score 234
Evalue 8.16542e-18
Total Hit Count 273
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22157
TTTTTTTTTTATAGTAATAATGGAAAATAGCAAATCTTTTATTTAGTCGGAGATAGCGGTACATCATGAGCACTCTGGCAATAACCAACTCATCACAAAC
ATGTGACGATTACGACAACACATCATGCACACACACACAACGAAATCCTTACGCACGCAGGTAACAGTGCGTGCTTGTACGTACGTAGAACCTGGAGAAG
TAGTACGTAGTTTCTCCGCAATCGAAATCCAGCCACACATAAAAACCAGCAGATGATTAAGAAATTAAAGCACACAACAAGTACGTAGTGGTACTTCAAA
TAGCCAGTCATGCATGCATGCGTGCGTGCATGAGGTATGGCGGATGCAGGGTCCGGCCGGCTCAGTTGGGGCACTGGAAGCCGGAGGGGACGTTCTTGCC
GCAGTTGTTGAGGACGAGGCTGAGGGCGATGGGCAAGGTCAGGTTGATGCCCAGAAGGTTGAGGTTCAGCGTCGTGCAGAGGCACAGCGCCGCCTCGAGG
TCCGCCAGCCCCTGGATCAGCGAGCAGCACGGCTGCACCGGCGGGCTCCCCAGGGTAAGGTTCAGCAGCCCGAGCACGTTCGCGCACACCCCCAGCTTCA
GCGCGTCCAGAGGGCACTGGGTGCTGTTTCCGCCCCCACCGTTGCCGCCGCCACCATTGCCACCGCCACCGTTTCCGCCGCCACCATTCCCACCGCCACC
GTTTCTTTGGTCGTTCGCGGGCCTTCTACATATTTGTATGTTTCCACTCTTTCGTGATTTCAGCTCATTTGGTGTAAAAGTTTGCCTTCGATTTGATGTA
CTCCTCGTGTCCGGTTCTGTATTAGTACGAGGCTATGGTCCATATACTTTG
page-top