Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22150  (registered. 2003)
Contig Information
Length 453 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit Os09g0558100 [Oryza sativa (japonica cultivar-group)] >gi|15214171|sp|Q9LRI7|OSR8_ORYSJ RecName: Full=Hydrophobic protein OSR8 >gi|9453850|dbj|BAB03289.1| hydrophobic polypeptide [Oryza sativa] >gi|52076928|dbj|BAD45939.1| unknown protein [Oryza sativa Japonica Group] >gi|113632142|dbj|BAF25823.1| Os09g0558100 [Oryza sativa (japonica cultivar-group)] >gi|125564680|gb|EAZ10060.1| hypothetical protein OsI_32364 [Oryza sativa Indica Group] >gi|215692883|dbj|BAG88303.1| unnamed protein product [Oryza sativa Japonica Group]
Score 259
Evalue 2.77062e-21
Total Hit Count 397
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22150
TTTTTTTTTTGGAAAAAATNTTCAGAGATGAAATTTATTCGGTTGTATGAGAATCACAGGAAGGCACGCCACACAGTGCAGATGGAAACACACACACACA
CACACACACACACACACGATGTTGATTCGCACGGCATGAGTTGCTACAGGACATCAAGCAAGGGCGTCGTAGTCCTTGCCGCTCTCCTCCGAGGCCGAGC
CATGCGCGACGAGCACGTAGATGGCGTAGATGATGCCGGGGATGTAGCCCAGGATGGTGAGCAGCAGACAGATCAAGAACTCCATGCTGCAGCAGCCGTA
GCGGAGGAAGACGCCGAGCGGCGGCAGGATGACGGCGAGCAGGATCTCGACGAAGGTGCAGCTTCGGGACGCCATCGGGGATGGAGATCTCTCTCTCTCT
CTCTCTCCCTCTCTCTTGCTCTGCTGGTCCGGGGAGTTTGGATTGGGGCCGCC
page-top